introduction of article research

How to Write a Research Paper Introduction (with Examples)

The research paper introduction section, along with the Title and Abstract, can be considered the face of any research paper. The following article is intended to guide you in organizing and writing the research paper introduction for a quality academic article or dissertation.

The research paper introduction aims to present the topic to the reader. A study will only be accepted for publishing if you can ascertain that the available literature cannot answer your research question. So it is important to ensure that you have read important studies on that particular topic, especially those within the last five to ten years, and that they are properly referenced in this section. 1 What should be included in the research paper introduction is decided by what you want to tell readers about the reason behind the research and how you plan to fill the knowledge gap. The best research paper introduction provides a systemic review of existing work and demonstrates additional work that needs to be done. It needs to be brief, captivating, and well-referenced; a well-drafted research paper introduction will help the researcher win half the battle.

The introduction for a research paper is where you set up your topic and approach for the reader. It has several key goals:

• Present your research topic
• Capture reader interest
• Summarize existing research
• Position your own approach
• Define your specific research problem and problem statement
• Highlight the novelty and contributions of the study
• Give an overview of the paper’s structure

The research paper introduction can vary in size and structure depending on whether your paper presents the results of original empirical research or is a review paper. Some research paper introduction examples are only half a page while others are a few pages long. In many cases, the introduction will be shorter than all of the other sections of your paper; its length depends on the size of your paper as a whole.

• Break through writer’s block. Write your research paper introduction with Paperpal Copilot

Table of Contents

What is the introduction for a research paper, why is the introduction important in a research paper, craft a compelling introduction section with paperpal. try now, 1. introduce the research topic:, 2. determine a research niche:, 3. place your research within the research niche:, craft accurate research paper introductions with paperpal. start writing now, frequently asked questions on research paper introduction, key points to remember.

The introduction in a research paper is placed at the beginning to guide the reader from a broad subject area to the specific topic that your research addresses. They present the following information to the reader

• Scope: The topic covered in the research paper
• Context: Background of your topic
• Importance: Why your research matters in that particular area of research and the industry problem that can be targeted

The research paper introduction conveys a lot of information and can be considered an essential roadmap for the rest of your paper. A good introduction for a research paper is important for the following reasons:

• It stimulates your reader’s interest: A good introduction section can make your readers want to read your paper by capturing their interest. It informs the reader what they are going to learn and helps determine if the topic is of interest to them.
• It helps the reader understand the research background: Without a clear introduction, your readers may feel confused and even struggle when reading your paper. A good research paper introduction will prepare them for the in-depth research to come. It provides you the opportunity to engage with the readers and demonstrate your knowledge and authority on the specific topic.
• It explains why your research paper is worth reading: Your introduction can convey a lot of information to your readers. It introduces the topic, why the topic is important, and how you plan to proceed with your research.
• It helps guide the reader through the rest of the paper: The research paper introduction gives the reader a sense of the nature of the information that will support your arguments and the general organization of the paragraphs that will follow. It offers an overview of what to expect when reading the main body of your paper.

What are the parts of introduction in the research?

A good research paper introduction section should comprise three main elements: 2

• What is known: This sets the stage for your research. It informs the readers of what is known on the subject.
• What is lacking: This is aimed at justifying the reason for carrying out your research. This could involve investigating a new concept or method or building upon previous research.
• What you aim to do: This part briefly states the objectives of your research and its major contributions. Your detailed hypothesis will also form a part of this section.

How to write a research paper introduction?

The first step in writing the research paper introduction is to inform the reader what your topic is and why it’s interesting or important. This is generally accomplished with a strong opening statement. The second step involves establishing the kinds of research that have been done and ending with limitations or gaps in the research that you intend to address. Finally, the research paper introduction clarifies how your own research fits in and what problem it addresses. If your research involved testing hypotheses, these should be stated along with your research question. The hypothesis should be presented in the past tense since it will have been tested by the time you are writing the research paper introduction.

The following key points, with examples, can guide you when writing the research paper introduction section:

• Highlight the importance of the research field or topic
• Describe the background of the topic
• Present an overview of current research on the topic

Example: The inclusion of experiential and competency-based learning has benefitted electronics engineering education. Industry partnerships provide an excellent alternative for students wanting to engage in solving real-world challenges. Industry-academia participation has grown in recent years due to the need for skilled engineers with practical training and specialized expertise. However, from the educational perspective, many activities are needed to incorporate sustainable development goals into the university curricula and consolidate learning innovation in universities.

• Reveal a gap in existing research or oppose an existing assumption
• Formulate the research question

Example: There have been plausible efforts to integrate educational activities in higher education electronics engineering programs. However, very few studies have considered using educational research methods for performance evaluation of competency-based higher engineering education, with a focus on technical and or transversal skills. To remedy the current need for evaluating competencies in STEM fields and providing sustainable development goals in engineering education, in this study, a comparison was drawn between study groups without and with industry partners.

• State the purpose of your study
• Highlight the key characteristics of your study
• Describe important results
• Highlight the novelty of the study.
• Offer a brief overview of the structure of the paper.

Example: The study evaluates the main competency needed in the applied electronics course, which is a fundamental core subject for many electronics engineering undergraduate programs. We compared two groups, without and with an industrial partner, that offered real-world projects to solve during the semester. This comparison can help determine significant differences in both groups in terms of developing subject competency and achieving sustainable development goals.

Write a Research Paper Introduction in Minutes with Paperpal

Paperpal Copilot is a generative AI-powered academic writing assistant. It’s trained on millions of published scholarly articles and over 20 years of STM experience. Paperpal Copilot helps authors write better and faster with:

• Real-time writing suggestions
• In-depth checks for language and grammar correction
• Paraphrasing to add variety, ensure academic tone, and trim text to meet journal limits

With Paperpal Copilot, create a research paper introduction effortlessly. In this step-by-step guide, we’ll walk you through how Paperpal transforms your initial ideas into a polished and publication-ready introduction.

How to use Paperpal to write the Introduction section

Step 1: Sign up on Paperpal and click on the Copilot feature, under this choose Outlines > Research Article > Introduction

Step 2: Add your unstructured notes or initial draft, whether in English or another language, to Paperpal, which is to be used as the base for your content.

Step 3: Fill in the specifics, such as your field of study, brief description or details you want to include, which will help the AI generate the outline for your Introduction.

Step 4: Use this outline and sentence suggestions to develop your content, adding citations where needed and modifying it to align with your specific research focus.

Step 5: Turn to Paperpal’s granular language checks to refine your content, tailor it to reflect your personal writing style, and ensure it effectively conveys your message.

You can use the same process to develop each section of your article, and finally your research paper in half the time and without any of the stress.

The purpose of the research paper introduction is to introduce the reader to the problem definition, justify the need for the study, and describe the main theme of the study. The aim is to gain the reader’s attention by providing them with necessary background information and establishing the main purpose and direction of the research.

The length of the research paper introduction can vary across journals and disciplines. While there are no strict word limits for writing the research paper introduction, an ideal length would be one page, with a maximum of 400 words over 1-4 paragraphs. Generally, it is one of the shorter sections of the paper as the reader is assumed to have at least a reasonable knowledge about the topic. 2 For example, for a study evaluating the role of building design in ensuring fire safety, there is no need to discuss definitions and nature of fire in the introduction; you could start by commenting upon the existing practices for fire safety and how your study will add to the existing knowledge and practice.

When deciding what to include in the research paper introduction, the rest of the paper should also be considered. The aim is to introduce the reader smoothly to the topic and facilitate an easy read without much dependency on external sources. 3 Below is a list of elements you can include to prepare a research paper introduction outline and follow it when you are writing the research paper introduction. Topic introduction: This can include key definitions and a brief history of the topic. Research context and background: Offer the readers some general information and then narrow it down to specific aspects. Details of the research you conducted: A brief literature review can be included to support your arguments or line of thought. Rationale for the study: This establishes the relevance of your study and establishes its importance. Importance of your research: The main contributions are highlighted to help establish the novelty of your study Research hypothesis: Introduce your research question and propose an expected outcome. Organization of the paper: Include a short paragraph of 3-4 sentences that highlights your plan for the entire paper

Cite only works that are most relevant to your topic; as a general rule, you can include one to three. Note that readers want to see evidence of original thinking. So it is better to avoid using too many references as it does not leave much room for your personal standpoint to shine through. Citations in your research paper introduction support the key points, and the number of citations depend on the subject matter and the point discussed. If the research paper introduction is too long or overflowing with citations, it is better to cite a few review articles rather than the individual articles summarized in the review. A good point to remember when citing research papers in the introduction section is to include at least one-third of the references in the introduction.

The literature review plays a significant role in the research paper introduction section. A good literature review accomplishes the following: Introduces the topic – Establishes the study’s significance – Provides an overview of the relevant literature – Provides context for the study using literature – Identifies knowledge gaps However, remember to avoid making the following mistakes when writing a research paper introduction: Do not use studies from the literature review to aggressively support your research Avoid direct quoting Do not allow literature review to be the focus of this section. Instead, the literature review should only aid in setting a foundation for the manuscript.

Remember the following key points for writing a good research paper introduction: 4

• Avoid stuffing too much general information: Avoid including what an average reader would know and include only that information related to the problem being addressed in the research paper introduction. For example, when describing a comparative study of non-traditional methods for mechanical design optimization, information related to the traditional methods and differences between traditional and non-traditional methods would not be relevant. In this case, the introduction for the research paper should begin with the state-of-the-art non-traditional methods and methods to evaluate the efficiency of newly developed algorithms.
• Avoid packing too many references: Cite only the required works in your research paper introduction. The other works can be included in the discussion section to strengthen your findings.
• Avoid extensive criticism of previous studies: Avoid being overly critical of earlier studies while setting the rationale for your study. A better place for this would be the Discussion section, where you can highlight the advantages of your method.
• Avoid describing conclusions of the study: When writing a research paper introduction remember not to include the findings of your study. The aim is to let the readers know what question is being answered. The actual answer should only be given in the Results and Discussion section.

To summarize, the research paper introduction section should be brief yet informative. It should convince the reader the need to conduct the study and motivate him to read further. If you’re feeling stuck or unsure, choose trusted AI academic writing assistants like Paperpal to effortlessly craft your research paper introduction and other sections of your research article.

1. Jawaid, S. A., & Jawaid, M. (2019). How to write introduction and discussion. Saudi Journal of Anaesthesia, 13(Suppl 1), S18.

2. Dewan, P., & Gupta, P. (2016). Writing the title, abstract and introduction: Looks matter!. Indian pediatrics, 53, 235-241.

3. Cetin, S., & Hackam, D. J. (2005). An approach to the writing of a scientific Manuscript1. Journal of Surgical Research, 128(2), 165-167.

4. Bavdekar, S. B. (2015). Writing introduction: Laying the foundations of a research paper. Journal of the Association of Physicians of India, 63(7), 44-6.

Paperpal is a comprehensive AI writing toolkit that helps students and researchers achieve 2x the writing in half the time. It leverages 21+ years of STM experience and insights from millions of research articles to provide in-depth academic writing, language editing, and submission readiness support to help you write better, faster.  

Get accurate academic translations, rewriting support, grammar checks, vocabulary suggestions, and generative AI assistance that delivers human precision at machine speed. Try for free or upgrade to Paperpal Prime starting at US$19 a month to access premium features, including consistency, plagiarism, and 30+ submission readiness checks to help you succeed.  

Experience the future of academic writing – Sign up to Paperpal and start writing for free!  

Related Reads:

• Scientific Writing Style Guides Explained
• 5 Reasons for Rejection After Peer Review
• Ethical Research Practices For Research with Human Subjects
• 8 Most Effective Ways to Increase Motivation for Thesis Writing 

Practice vs. Practise: Learn the Difference

Academic paraphrasing: why paperpal’s rewrite should be your first choice , you may also like, how to cite in apa format (7th edition):..., how to write your research paper in apa..., how to choose a dissertation topic, how to write a phd research proposal, how to write an academic paragraph (step-by-step guide), research funding basics: what should a grant proposal..., how to write an abstract in research papers..., how to write dissertation acknowledgements, how to write the first draft of a..., mla works cited page: format, template & examples.

• PRO Courses Guides New Tech Help Pro Expert Videos About wikiHow Pro Upgrade Sign In
• EDIT Edit this Article
• EXPLORE Tech Help Pro About Us Random Article Quizzes Request a New Article Community Dashboard This Or That Game Happiness Hub Popular Categories Arts and Entertainment Artwork Books Movies Computers and Electronics Computers Phone Skills Technology Hacks Health Men's Health Mental Health Women's Health Relationships Dating Love Relationship Issues Hobbies and Crafts Crafts Drawing Games Education & Communication Communication Skills Personal Development Studying Personal Care and Style Fashion Hair Care Personal Hygiene Youth Personal Care School Stuff Dating All Categories Arts and Entertainment Finance and Business Home and Garden Relationship Quizzes Cars & Other Vehicles Food and Entertaining Personal Care and Style Sports and Fitness Computers and Electronics Health Pets and Animals Travel Education & Communication Hobbies and Crafts Philosophy and Religion Work World Family Life Holidays and Traditions Relationships Youth
• Browse Articles
• Learn Something New
• Quizzes Hot
• Happiness Hub
• This Or That Game
• Train Your Brain
• Explore More
• Support wikiHow
• About wikiHow
• Log in / Sign up
• Education and Communications
• College University and Postgraduate
• Academic Writing
• Research Papers

How to Write a Research Introduction

Last Updated: December 6, 2023 Fact Checked

This article was co-authored by Megan Morgan, PhD . Megan Morgan is a Graduate Program Academic Advisor in the School of Public & International Affairs at the University of Georgia. She earned her PhD in English from the University of Georgia in 2015. There are 7 references cited in this article, which can be found at the bottom of the page. This article has been fact-checked, ensuring the accuracy of any cited facts and confirming the authority of its sources. This article has been viewed 2,656,659 times.

The introduction to a research paper can be the most challenging part of the paper to write. The length of the introduction will vary depending on the type of research paper you are writing. An introduction should announce your topic, provide context and a rationale for your work, before stating your research questions and hypothesis. Well-written introductions set the tone for the paper, catch the reader's interest, and communicate the hypothesis or thesis statement.

Introducing the Topic of the Paper

• In scientific papers this is sometimes known as an "inverted triangle", where you start with the broadest material at the start, before zooming in on the specifics. [2] X Research source
• The sentence "Throughout the 20th century, our views of life on other planets have drastically changed" introduces a topic, but does so in broad terms.
• It provides the reader with an indication of the content of the essay and encourages them to read on.

• For example, if you were writing a paper about the behaviour of mice when exposed to a particular substance, you would include the word "mice", and the scientific name of the relevant compound in the first sentences.
• If you were writing a history paper about the impact of the First World War on gender relations in Britain, you should mention those key words in your first few lines.

• This is especially important if you are attempting to develop a new conceptualization that uses language and terminology your readers may be unfamiliar with.

• If you use an anecdote ensure that is short and highly relevant for your research. It has to function in the same way as an alternative opening, namely to announce the topic of your research paper to your reader.
• For example, if you were writing a sociology paper about re-offending rates among young offenders, you could include a brief story of one person whose story reflects and introduces your topic.
• This kind of approach is generally not appropriate for the introduction to a natural or physical sciences research paper where the writing conventions are different.

Establishing the Context for Your Paper

• It is important to be concise in the introduction, so provide an overview on recent developments in the primary research rather than a lengthy discussion.
• You can follow the "inverted triangle" principle to focus in from the broader themes to those to which you are making a direct contribution with your paper.
• A strong literature review presents important background information to your own research and indicates the importance of the field.

• By making clear reference to existing work you can demonstrate explicitly the specific contribution you are making to move the field forward.
• You can identify a gap in the existing scholarship and explain how you are addressing it and moving understanding forward.

• For example, if you are writing a scientific paper you could stress the merits of the experimental approach or models you have used.
• Stress what is novel in your research and the significance of your new approach, but don't give too much detail in the introduction.
• A stated rationale could be something like: "the study evaluates the previously unknown anti-inflammatory effects of a topical compound in order to evaluate its potential clinical uses".

Specifying Your Research Questions and Hypothesis

• The research question or questions generally come towards the end of the introduction, and should be concise and closely focused.
• The research question might recall some of the key words established in the first few sentences and the title of your paper.
• An example of a research question could be "what were the consequences of the North American Free Trade Agreement on the Mexican export economy?"
• This could be honed further to be specific by referring to a particular element of the Free Trade Agreement and the impact on a particular industry in Mexico, such as clothing manufacture.
• A good research question should shape a problem into a testable hypothesis.

• If possible try to avoid using the word "hypothesis" and rather make this implicit in your writing. This can make your writing appear less formulaic.
• In a scientific paper, giving a clear one-sentence overview of your results and their relation to your hypothesis makes the information clear and accessible. [10] X Trustworthy Source PubMed Central Journal archive from the U.S. National Institutes of Health Go to source
• An example of a hypothesis could be "mice deprived of food for the duration of the study were expected to become more lethargic than those fed normally".

• This is not always necessary and you should pay attention to the writing conventions in your discipline.
• In a natural sciences paper, for example, there is a fairly rigid structure which you will be following.
• A humanities or social science paper will most likely present more opportunities to deviate in how you structure your paper.

Research Introduction Help

Community Q&A

• Use your research papers' outline to help you decide what information to include when writing an introduction. Thanks Helpful 0 Not Helpful 1
• Consider drafting your introduction after you have already completed the rest of your research paper. Writing introductions last can help ensure that you don't leave out any major points. Thanks Helpful 0 Not Helpful 0

• Avoid emotional or sensational introductions; these can create distrust in the reader. Thanks Helpful 51 Not Helpful 12
• Generally avoid using personal pronouns in your introduction, such as "I," "me," "we," "us," "my," "mine," or "our." Thanks Helpful 32 Not Helpful 7
• Don't overwhelm the reader with an over-abundance of information. Keep the introduction as concise as possible by saving specific details for the body of your paper. Thanks Helpful 25 Not Helpful 14

You Might Also Like

• ↑ https://library.sacredheart.edu/c.php?g=29803&p=185916
• ↑ https://www.aresearchguide.com/inverted-pyramid-structure-in-writing.html
• ↑ https://libguides.usc.edu/writingguide/introduction
• ↑ https://writing.wisc.edu/Handbook/PlanResearchPaper.html
• ↑ https://dept.writing.wisc.edu/wac/writing-an-introduction-for-a-scientific-paper/
• ↑ https://writing.wisc.edu/handbook/assignments/planresearchpaper/
• ↑ http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3178846/

About This Article

To introduce your research paper, use the first 1-2 sentences to describe your general topic, such as “women in World War I.” Include and define keywords, such as “gender relations,” to show your reader where you’re going. Mention previous research into the topic with a phrase like, “Others have studied…”, then transition into what your contribution will be and why it’s necessary. Finally, state the questions that your paper will address and propose your “answer” to them as your thesis statement. For more information from our English Ph.D. co-author about how to craft a strong hypothesis and thesis, keep reading! Did this summary help you? Yes No

• Send fan mail to authors

Reader Success Stories

Abdulrahman Omar

Oct 5, 2018

Did this article help you?

May 9, 2021

Lavanya Gopakumar

Oct 1, 2016

Dengkai Zhang

May 14, 2018

Leslie Mae Cansana

Sep 22, 2016

Featured Articles

Trending Articles

Watch Articles

• Terms of Use
• Privacy Policy
• Do Not Sell or Share My Info
• Not Selling Info

wikiHow Tech Help Pro:

Develop the tech skills you need for work and life

• Privacy Policy

Home » Research Paper Introduction – Writing Guide and Examples

Research Paper Introduction – Writing Guide and Examples

Table of Contents

Research Paper Introduction

Research paper introduction is the first section of a research paper that provides an overview of the study, its purpose, and the research question (s) or hypothesis (es) being investigated. It typically includes background information about the topic, a review of previous research in the field, and a statement of the research objectives. The introduction is intended to provide the reader with a clear understanding of the research problem, why it is important, and how the study will contribute to existing knowledge in the field. It also sets the tone for the rest of the paper and helps to establish the author’s credibility and expertise on the subject.

How to Write Research Paper Introduction

Writing an introduction for a research paper can be challenging because it sets the tone for the entire paper. Here are some steps to follow to help you write an effective research paper introduction:

• Start with a hook : Begin your introduction with an attention-grabbing statement, a question, or a surprising fact that will make the reader interested in reading further.
• Provide background information: After the hook, provide background information on the topic. This information should give the reader a general idea of what the topic is about and why it is important.
• State the research problem: Clearly state the research problem or question that the paper addresses. This should be done in a concise and straightforward manner.
• State the research objectives: After stating the research problem, clearly state the research objectives. This will give the reader an idea of what the paper aims to achieve.
• Provide a brief overview of the paper: At the end of the introduction, provide a brief overview of the paper. This should include a summary of the main points that will be discussed in the paper.
• Revise and refine: Finally, revise and refine your introduction to ensure that it is clear, concise, and engaging.

Structure of Research Paper Introduction

The following is a typical structure for a research paper introduction:

• Background Information: This section provides an overview of the topic of the research paper, including relevant background information and any previous research that has been done on the topic. It helps to give the reader a sense of the context for the study.
• Problem Statement: This section identifies the specific problem or issue that the research paper is addressing. It should be clear and concise, and it should articulate the gap in knowledge that the study aims to fill.
• Research Question/Hypothesis : This section states the research question or hypothesis that the study aims to answer. It should be specific and focused, and it should clearly connect to the problem statement.
• Significance of the Study: This section explains why the research is important and what the potential implications of the study are. It should highlight the contribution that the research makes to the field.
• Methodology: This section describes the research methods that were used to conduct the study. It should be detailed enough to allow the reader to understand how the study was conducted and to evaluate the validity of the results.
• Organization of the Paper : This section provides a brief overview of the structure of the research paper. It should give the reader a sense of what to expect in each section of the paper.

Research Paper Introduction Examples

Research Paper Introduction Examples could be:

Example 1: In recent years, the use of artificial intelligence (AI) has become increasingly prevalent in various industries, including healthcare. AI algorithms are being developed to assist with medical diagnoses, treatment recommendations, and patient monitoring. However, as the use of AI in healthcare grows, ethical concerns regarding privacy, bias, and accountability have emerged. This paper aims to explore the ethical implications of AI in healthcare and propose recommendations for addressing these concerns.

Example 2: Climate change is one of the most pressing issues facing our planet today. The increasing concentration of greenhouse gases in the atmosphere has resulted in rising temperatures, changing weather patterns, and other environmental impacts. In this paper, we will review the scientific evidence on climate change, discuss the potential consequences of inaction, and propose solutions for mitigating its effects.

Example 3: The rise of social media has transformed the way we communicate and interact with each other. While social media platforms offer many benefits, including increased connectivity and access to information, they also present numerous challenges. In this paper, we will examine the impact of social media on mental health, privacy, and democracy, and propose solutions for addressing these issues.

Example 4: The use of renewable energy sources has become increasingly important in the face of climate change and environmental degradation. While renewable energy technologies offer many benefits, including reduced greenhouse gas emissions and energy independence, they also present numerous challenges. In this paper, we will assess the current state of renewable energy technology, discuss the economic and political barriers to its adoption, and propose solutions for promoting the widespread use of renewable energy.

Purpose of Research Paper Introduction

The introduction section of a research paper serves several important purposes, including:

• Providing context: The introduction should give readers a general understanding of the topic, including its background, significance, and relevance to the field.
• Presenting the research question or problem: The introduction should clearly state the research question or problem that the paper aims to address. This helps readers understand the purpose of the study and what the author hopes to accomplish.
• Reviewing the literature: The introduction should summarize the current state of knowledge on the topic, highlighting the gaps and limitations in existing research. This shows readers why the study is important and necessary.
• Outlining the scope and objectives of the study: The introduction should describe the scope and objectives of the study, including what aspects of the topic will be covered, what data will be collected, and what methods will be used.
• Previewing the main findings and conclusions : The introduction should provide a brief overview of the main findings and conclusions that the study will present. This helps readers anticipate what they can expect to learn from the paper.

When to Write Research Paper Introduction

The introduction of a research paper is typically written after the research has been conducted and the data has been analyzed. This is because the introduction should provide an overview of the research problem, the purpose of the study, and the research questions or hypotheses that will be investigated.

Once you have a clear understanding of the research problem and the questions that you want to explore, you can begin to write the introduction. It’s important to keep in mind that the introduction should be written in a way that engages the reader and provides a clear rationale for the study. It should also provide context for the research by reviewing relevant literature and explaining how the study fits into the larger field of research.

Advantages of Research Paper Introduction

The introduction of a research paper has several advantages, including:

• Establishing the purpose of the research: The introduction provides an overview of the research problem, question, or hypothesis, and the objectives of the study. This helps to clarify the purpose of the research and provide a roadmap for the reader to follow.
• Providing background information: The introduction also provides background information on the topic, including a review of relevant literature and research. This helps the reader understand the context of the study and how it fits into the broader field of research.
• Demonstrating the significance of the research: The introduction also explains why the research is important and relevant. This helps the reader understand the value of the study and why it is worth reading.
• Setting expectations: The introduction sets the tone for the rest of the paper and prepares the reader for what is to come. This helps the reader understand what to expect and how to approach the paper.
• Grabbing the reader’s attention: A well-written introduction can grab the reader’s attention and make them interested in reading further. This is important because it can help to keep the reader engaged and motivated to read the rest of the paper.
• Creating a strong first impression: The introduction is the first part of the research paper that the reader will see, and it can create a strong first impression. A well-written introduction can make the reader more likely to take the research seriously and view it as credible.
• Establishing the author’s credibility: The introduction can also establish the author’s credibility as a researcher. By providing a clear and thorough overview of the research problem and relevant literature, the author can demonstrate their expertise and knowledge in the field.
• Providing a structure for the paper: The introduction can also provide a structure for the rest of the paper. By outlining the main sections and sub-sections of the paper, the introduction can help the reader navigate the paper and find the information they are looking for.

About the author

Muhammad Hassan

Researcher, Academic Writer, Web developer

You may also like

Limitations in Research – Types, Examples and...

APA Table of Contents – Format and Example

Research Methodology – Types, Examples and...

Informed Consent in Research – Types, Templates...

Context of the Study – Writing Guide and Examples

Research Paper Abstract – Writing Guide and...

An official website of the United States government

The .gov means it’s official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

• Publications
• Account settings

Preview improvements coming to the PMC website in October 2024. Learn More or Try it out now .

• Advanced Search
• Journal List
• Turk J Urol
• v.39(Suppl 1); 2013 Sep

How to write an introduction section of a scientific article?

An article primarily includes the following sections: introduction, materials and methods, results, discussion, and conclusion. Before writing the introduction, the main steps, the heading and the familiarity level of the readers should be considered. Writing should begin when the experimental system and the equipment are available. The introduction section comprises the first portion of the manuscript, and it should be written using the simple present tense. Additionally, abbreviations and explanations are included in this section. The main goal of the introduction is to convey basic information to the readers without obligating them to investigate previous publications and to provide clues as to the results of the present study. To do this, the subject of the article should be thoroughly reviewed, and the aim of the study should be clearly stated immediately after discussing the basic references. In this review, we aim to convey the principles of writing the introduction section of a manuscript to residents and young investigators who have just begun to write a manuscript.

Introduction

When entering a gate of a magnificent city we can make a prediction about the splendor, pomposity, history, and civilization we will encounter in the city. Occasionally, gates do not give even a glimpse of the city, and it can mislead the visitors about inner sections of the city. Introduction sections of the articles are like gates of a city. It is a presentation aiming at introducing itself to the readers, and attracting their attention. Attractiveness, clarity, piquancy, and analytical capacity of the presentation will urge the reader to read the subsequent sections of the article. On the other hand as is understood from the motto of antique Greek poet Euripides “a bad beginning makes a bad ending”, ‘Introduction’ section of a scientific article is important in that it can reveal the conclusion of the article. [ 1 ]

It is useful to analyze the issues to be considered in the ‘Introduction’ section under 3 headings. Firstly, information should be provided about the general topic of the article in the light of the current literature which paves the way for the disclosure of the objective of the manuscript. Then the specific subject matter, and the issue to be focused on should be dealt with, the problem should be brought forth, and fundamental references related to the topic should be discussed. Finally, our recommendations for solution should be described, in other words our aim should be communicated. When these steps are followed in that order, the reader can track the problem, and its solution from his/her own perspective under the light of current literature. Otherwise, even a perfect study presented in a non-systematized, confused design will lose the chance of reading. Indeed inadequate information, inability to clarify the problem, and sometimes concealing the solution will keep the reader who has a desire to attain new information away from reading the manuscript. [ 1 – 3 ]

First of all, explanation of the topic in the light of the current literature should be made in clear, and precise terms as if the reader is completely ignorant of the subject. In this section, establishment of a warm rapport between the reader, and the manuscript is aimed. Since frantic plunging into the problem or the solution will push the reader into the dilemma of either screening the literature about the subject matter or refraining from reading the article. Updated, and robust information should be presented in the ‘Introduction’ section.

Then main topic of our manuscript, and the encountered problem should be analyzed in the light of the current literature following a short instance of brain exercise. At this point the problems should be reduced to one issue as far as possible. Of course, there might be more than one problem, however this new issue, and its solution should be the subject matter of another article. Problems should be expressed clearly. If targets are more numerous, and complex, solutions will be more than one, and confusing.

Finally, the last paragraphs of the ‘Introduction’ section should include the solution in which we will describe the information we generated, and related data. Our sentences which arouse curiosity in the readers should not be left unanswered. The reader who thinks to obtain the most effective information in no time while reading a scientific article should not be smothered with mysterious sentences, and word plays, and the readers should not be left alone to arrive at a conclusion by themselves. If we have contrary expectations, then we might write an article which won’t have any reader. A clearly expressed or recommended solutions to an explicitly revealed problem is also very important for the integrity of the ‘Introduction’ section. [ 1 – 5 ]

We can summarize our arguments with the following example ( Figure 1 ). The introduction section of the exemplary article is written in simple present tense which includes abbreviations, acronyms, and their explanations. Based on our statements above we can divide the introduction section into 3 parts. In the first paragraph, miniaturization, and evolvement of pediatric endourological instruments, and competitions among PNL, ESWL, and URS in the treatment of urinary system stone disease are described, in other words the background is prepared. In the second paragraph, a newly defined system which facilitates intrarenal access in PNL procedure has been described. Besides basic references related to the subject matter have been given, and their outcomes have been indicated. In other words, fundamental references concerning main subject have been discussed. In the last paragraph the aim of the researchers to investigate the outcomes, and safety of the application of this new method in the light of current information has been indicated.

An exemplary introduction section of an article

Apart from the abovementioned information about the introduction section of a scientific article we will summarize a few major issues in brief headings

Important points which one should take heed of:

• Abbreviations should be given following their explanations in the ‘Introduction’ section (their explanations in the summary does not count)
• Simple present tense should be used.
• References should be selected from updated publication with a higher impact factor, and prestigous source books.
• Avoid mysterious, and confounding expressions, construct clear sentences aiming at problematic issues, and their solutions.
• The sentences should be attractive, tempting, and comjprehensible.
• Firstly general, then subject-specific information should be given. Finally our aim should be clearly explained.

• Langson Library
• Science Library
• Grunigen Medical Library
• Law Library
• Connect From Off-Campus
• Accessibility
• Gateway Study Center

Email this link

Writing a scientific paper.

• Writing a lab report

What is a "good" introduction?

Citing sources in the introduction, "introduction checklist" from: how to write a good scientific paper. chris a. mack. spie. 2018..

• LITERATURE CITED
• Bibliography of guides to scientific writing and presenting
• Peer Review
• Presentations
• Lab Report Writing Guides on the Web

This is where you describe briefly and clearly why you are writing the paper. The introduction supplies sufficient background information for the reader to understand and evaluate the experiment you did. It also supplies a rationale for the study.

• Present the problem and the proposed solution
• Presents nature and scope of the problem investigated
• Reviews the pertinent literature to orient the reader
• States the method of the experiment
• State the principle results of the experiment

It is important to cite sources in the introduction section of your paper as evidence of the claims you are making. There are ways of citing sources in the text so that the reader can find the full reference in the literature cited section at the end of the paper, yet the flow of the reading is not badly interrupted. Below are some example of how this can be done:     "Smith (1983) found that N-fixing plants could be infected by several different species of Rhizobium."     "Walnut trees are known to be allelopathic (Smith 1949,  Bond et al. 1955, Jones and Green 1963)."     "Although the presence of Rhizobium normally increases the growth of legumes (Nguyen 1987), the opposite effect has been observed (Washington 1999)." Note that articles by one or two authors are always cited in the text using their last names. However, if there are more than two authors, the last name of the 1st author is given followed by the abbreviation et al. which is Latin for "and others". 

From:  https://writingcenter.gmu.edu/guides/imrad-reports-introductions

• Indicate the field of the work, why this field is important, and what has already been done (with proper citations).
• Indicate a gap, raise a research question, or challenge prior work in this territory.
• Outline the purpose and announce the present research, clearly indicating what is novel and why it is significant.
• Avoid: repeating the abstract; providing unnecessary background information; exaggerating the importance of the work; claiming novelty without a proper literature search. 
• << Previous: ABSTRACT
• Next: METHODS >>
• Last Updated: Aug 4, 2023 9:33 AM
• URL: https://guides.lib.uci.edu/scientificwriting

Off-campus? Please use the Software VPN and choose the group UCIFull to access licensed content. For more information, please Click here

Software VPN is not available for guests, so they may not have access to some content when connecting from off-campus.

How to Perfect the Introduction for your Research Article

How-to-perfect-the-introduction-for-your-research-article.

Patrick O'Connor, Author, Writing Scientific Research Articles: Strategy and Steps

February 08, 2022

The introduction – it’s an important part of a research article. It gives you the space to back up the claims in your abstract with evidence. The question is, how do you write an introduction for a research paper that successfully conveys the novelty, significance, and relevance your research has.

Guidelines for selecting, ordering, and presenting your evidence effectively are available from the field of Applied Linguistics (AL) over the past 25 years. Here we’ve created an easy-to-use summary just for authors.

6 ‘stages’ in developing your argument in an introduction

Yes, you are writing an argument. Your aim is to convince your reader that the study you have conducted is new, addresses an important question for the field, and is needed at the present time. AL analysis has identified 6 important argument stages that successful authors use to achieve that goal – note that they are not always used in the order listed here.

1. Present the context or background to your study, claiming its importance to the field and to the interests of the journal’s readers.

2. Lay a foundation of information already known by presenting findings of other researchers on aspects of the problem you addressed.

3. Indicate the need for more investigation by highlighting a gap in the existing work, showing a need for extension of the work, or creating a research ‘niche’ that your study fills.

4. Three alternatives here, depending on your research field and the journal’s conventions: a) state the purpose/objectives of your study; OR outline the main activity of the paper or study (e.g. ‘here we analyze … and investigate …’), OR summarize the findings of the study (used in some fields/journals only).

5. Optionally, highlight a positive value or benefit of carrying out the study.

6. In some research fields only – include a ‘map’ of how the rest of the article is organized. You will know whether you need this stage from reading a selection of recent articles from your target journal. This is a very important strategy for all of us as we prepare a manuscript for submission – analyze well-cited examples from your target journal.

Use the writing process to clarify your argument

Our experience indicates that it cuts down the time needed to reach an effective introduction if you begin by writing your Stage 4 – it will come towards the end in the final draft, of course, but writing it first helps you map out what evidence you need in the other stages. The Stage 4 should emerge from robust analysis and interpretation of your results in the context of previous research. Make sure that your Stage 4 sentences are comprehensive and include all the parameters that make your study novel and significant. Once you and your co-authors are happy with the wording of Stage 4, write a clear Stage 3 – don’t leave it to your readers to guess or make assumptions about the gap you are aiming to fill or the problem you are addressing.

Then you can underline the key terms in your Stages 3 and 4 that need to be introduced and justified in the earlier stages of the introduction. You may need to write more than one paragraph of Stage 1/2 information, especially if there are several ‘strands’ to the rationale for your study – but it will be clear what is needed now. Try several ways of ordering this information, to get the clearest logical flow and target the interests of the journal readers at the beginning.

To help develop your skills for writing introductions, it is useful to analyze successful examples from your own field of research.

For more on using this method to improve your skills in writing an effective research article, see our popular book  ‘Writing Scientific Research Articles: Strategy and Steps, 2nd Edition’ .

You can also find help at Wiley Author Services.  Learn more .

Watch our Webinar to help you get published

Please enter your Email Address

Please enter valid email address

Please Enter your First Name

Please enter your Last Name

Please enter your Questions or Comments.

Please enter the Privacy

Please enter the Terms & Conditions

Your Guide to Publishing

3 article-level metrics to understand your work’s impact

How to write a clinical case report

How to Write A Lay Summary for Your Research

Think. Check. Submit your way to the right journal

10 Ways to Reduce the Word Count of Your Research Paper

Writing for Publication- How Can a Structured Writing Retreat Help?

Infographic: 6 Steps for Writing a Literature Review

How to turn your dissertation into journal articles

How to Choose Effective SEO Keywords for Your Research Article | How to Write a Journal Article

Related articles.

Wiley supports you throughout the manuscript preparation process,

Get a quick understanding of the metrics that matter for your research, what they can show you, and where to find them.

Editor-in-Chief of Clinical Case Reports, Charles Young, discusses what makes a good case report.

Late with a review report? Find out how to handle the situation in this blog post from Andrew Moore, Editor-in-Chief of Bioessays.

Find out more about "Think.Check.Submit", a cross-industry initiative designed to support researchers on the road to publication.

Do you need some guidance on writing concisely? This presentation, originally published on Editage Insights, offers some quick tips to help you keep to your desired word count in academic writing.

Professor Rowena Murray looks back on a recent writing retreat and discusses how such retreats can help overcome writer's block.

This infographic sets out six simple steps&nbsp;to set you on your way to writing a successful and well thought out literature review.

Guidance for PhD students planning to turn dissertations into published journal articles.

Find 5 helpful tips about using keywords in your research article to help journals, and your article, be found more easily by researchers.

Helping authors to bypass article formatting headaches

Improving the author's experience with a simpler submission process and fewer formatting requirements. Release of the pilot program, free format submission.

Get Published: Your How-to Guide

Your how-to guide to get an in-depth understanding of the publishing journey.

FOR INDIVIDUALS

FOR INSTITUTIONS & BUSINESSES

WILEY NETWORK

ABOUT WILEY

Corporate Responsibility

Corporate Governance

Leadership Team

Cookie Preferences

Copyright @ 2000-2024  by John Wiley & Sons, Inc., or related companies. All rights reserved, including rights for text and data mining and training of artificial technologies or similar technologies.

Rights & Permissions

Privacy Policy

Terms of Use

How to write an effective introduction for your research paper

Last updated

20 January 2024

Reviewed by

However, the introduction is a vital element of your research paper . It helps the reader decide whether your paper is worth their time. As such, it's worth taking your time to get it right.

In this article, we'll tell you everything you need to know about writing an effective introduction for your research paper.

• The importance of an introduction in research papers

The primary purpose of an introduction is to provide an overview of your paper. This lets readers gauge whether they want to continue reading or not. The introduction should provide a meaningful roadmap of your research to help them make this decision. It should let readers know whether the information they're interested in is likely to be found in the pages that follow.

Aside from providing readers with information about the content of your paper, the introduction also sets the tone. It shows readers the style of language they can expect, which can further help them to decide how far to read.

When you take into account both of these roles that an introduction plays, it becomes clear that crafting an engaging introduction is the best way to get your paper read more widely. First impressions count, and the introduction provides that impression to readers.

• The optimum length for a research paper introduction

While there's no magic formula to determine exactly how long a research paper introduction should be, there are a few guidelines. Some variables that impact the ideal introduction length include:

Field of study

Complexity of the topic

Specific requirements of the course or publication

A commonly recommended length of a research paper introduction is around 10% of the total paper’s length. So, a ten-page paper has a one-page introduction. If the topic is complex, it may require more background to craft a compelling intro. Humanities papers tend to have longer introductions than those of the hard sciences.

The best way to craft an introduction of the right length is to focus on clarity and conciseness. Tell the reader only what is necessary to set up your research. An introduction edited down with this goal in mind should end up at an acceptable length.

• Evaluating successful research paper introductions

A good way to gauge how to create a great introduction is by looking at examples from across your field. The most influential and well-regarded papers should provide some insights into what makes a good introduction.

Dissecting examples: what works and why

We can make some general assumptions by looking at common elements of a good introduction, regardless of the field of research.

A common structure is to start with a broad context, and then narrow that down to specific research questions or hypotheses. This creates a funnel that establishes the scope and relevance.

The most effective introductions are careful about the assumptions they make regarding reader knowledge. By clearly defining key terms and concepts instead of assuming the reader is familiar with them, these introductions set a more solid foundation for understanding.

To pull in the reader and make that all-important good first impression, excellent research paper introductions will often incorporate a compelling narrative or some striking fact that grabs the reader's attention.

Finally, good introductions provide clear citations from past research to back up the claims they're making. In the case of argumentative papers or essays (those that take a stance on a topic or issue), a strong thesis statement compels the reader to continue reading.

Common pitfalls to avoid in research paper introductions

You can also learn what not to do by looking at other research papers. Many authors have made mistakes you can learn from.

We've talked about the need to be clear and concise. Many introductions fail at this; they're verbose, vague, or otherwise fail to convey the research problem or hypothesis efficiently. This often comes in the form of an overemphasis on background information, which obscures the main research focus.

Ensure your introduction provides the proper emphasis and excitement around your research and its significance. Otherwise, fewer people will want to read more about it.

• Crafting a compelling introduction for a research paper

Let’s take a look at the steps required to craft an introduction that pulls readers in and compels them to learn more about your research.

Step 1: Capturing interest and setting the scene

To capture the reader's interest immediately, begin your introduction with a compelling question, a surprising fact, a provocative quote, or some other mechanism that will hook readers and pull them further into the paper.

As they continue reading, the introduction should contextualize your research within the current field, showing readers its relevance and importance. Clarify any essential terms that will help them better understand what you're saying. This keeps the fundamentals of your research accessible to all readers from all backgrounds.

Step 2: Building a solid foundation with background information

Including background information in your introduction serves two major purposes:

It helps to clarify the topic for the reader

It establishes the depth of your research

The approach you take when conveying this information depends on the type of paper.

For argumentative papers, you'll want to develop engaging background narratives. These should provide context for the argument you'll be presenting.

For empirical papers, highlighting past research is the key. Often, there will be some questions that weren't answered in those past papers. If your paper is focused on those areas, those papers make ideal candidates for you to discuss and critique in your introduction.

Step 3: Pinpointing the research challenge

To capture the attention of the reader, you need to explain what research challenges you'll be discussing.

For argumentative papers, this involves articulating why the argument you'll be making is important. What is its relevance to current discussions or problems? What is the potential impact of people accepting or rejecting your argument?

For empirical papers, explain how your research is addressing a gap in existing knowledge. What new insights or contributions will your research bring to your field?

Step 4: Clarifying your research aims and objectives

We mentioned earlier that the introduction to a research paper can serve as a roadmap for what's within. We've also frequently discussed the need for clarity. This step addresses both of these.

When writing an argumentative paper, craft a thesis statement with impact. Clearly articulate what your position is and the main points you intend to present. This will map out for the reader exactly what they'll get from reading the rest.

For empirical papers, focus on formulating precise research questions and hypotheses. Directly link them to the gaps or issues you've identified in existing research to show the reader the precise direction your research paper will take.

Step 5: Sketching the blueprint of your study

Continue building a roadmap for your readers by designing a structured outline for the paper. Guide the reader through your research journey, explaining what the different sections will contain and their relationship to one another.

This outline should flow seamlessly as you move from section to section. Creating this outline early can also help guide the creation of the paper itself, resulting in a final product that's better organized. In doing so, you'll craft a paper where each section flows intuitively from the next.

Step 6: Integrating your research question

To avoid letting your research question get lost in background information or clarifications, craft your introduction in such a way that the research question resonates throughout. The research question should clearly address a gap in existing knowledge or offer a new perspective on an existing problem.

Tell users your research question explicitly but also remember to frequently come back to it. When providing context or clarification, point out how it relates to the research question. This keeps your focus where it needs to be and prevents the topic of the paper from becoming under-emphasized.

Step 7: Establishing the scope and limitations

So far, we've talked mostly about what's in the paper and how to convey that information to readers. The opposite is also important. Information that's outside the scope of your paper should be made clear to the reader in the introduction so their expectations for what is to follow are set appropriately.

Similarly, be honest and upfront about the limitations of the study. Any constraints in methodology, data, or how far your findings can be generalized should be fully communicated in the introduction.

Step 8: Concluding the introduction with a promise

The final few lines of the introduction are your last chance to convince people to continue reading the rest of the paper. Here is where you should make it very clear what benefit they'll get from doing so. What topics will be covered? What questions will be answered? Make it clear what they will get for continuing.

By providing a quick recap of the key points contained in the introduction in its final lines and properly setting the stage for what follows in the rest of the paper, you refocus the reader's attention on the topic of your research and guide them to read more.

• Research paper introduction best practices

Following the steps above will give you a compelling introduction that hits on all the key points an introduction should have. Some more tips and tricks can make an introduction even more polished.

As you follow the steps above, keep the following tips in mind.

Set the right tone and style

Like every piece of writing, a research paper should be written for the audience. That is to say, it should match the tone and style that your academic discipline and target audience expect. This is typically a formal and academic tone, though the degree of formality varies by field.

Kno w the audience

The perfect introduction balances clarity with conciseness. The amount of clarification required for a given topic depends greatly on the target audience. Knowing who will be reading your paper will guide you in determining how much background information is required.

Adopt the CARS (create a research space) model

The CARS model is a helpful tool for structuring introductions. This structure has three parts. The beginning of the introduction establishes the general research area. Next, relevant literature is reviewed and critiqued. The final section outlines the purpose of your study as it relates to the previous parts.

Master the art of funneling

The CARS method is one example of a well-funneled introduction. These start broadly and then slowly narrow down to your specific research problem. It provides a nice narrative flow that provides the right information at the right time. If you stray from the CARS model, try to retain this same type of funneling.

Incorporate narrative element

People read research papers largely to be informed. But to inform the reader, you have to hold their attention. A narrative style, particularly in the introduction, is a great way to do that. This can be a compelling story, an intriguing question, or a description of a real-world problem.

Write the introduction last

By writing the introduction after the rest of the paper, you'll have a better idea of what your research entails and how the paper is structured. This prevents the common problem of writing something in the introduction and then forgetting to include it in the paper. It also means anything particularly exciting in the paper isn’t neglected in the intro.

Should you be using a customer insights hub?

Do you want to discover previous research faster?

Do you share your research findings with others?

Do you analyze research data?

Start for free today, add your research, and get to key insights faster

Editor’s picks

Last updated: 18 April 2023

Last updated: 27 February 2023

Last updated: 22 August 2024

Last updated: 5 February 2023

Last updated: 16 August 2024

Last updated: 9 March 2023

Last updated: 30 April 2024

Last updated: 12 December 2023

Last updated: 11 March 2024

Last updated: 4 July 2024

Last updated: 6 March 2024

Last updated: 5 March 2024

Last updated: 13 May 2024

Latest articles

Related topics, .css-je19u9{-webkit-align-items:flex-end;-webkit-box-align:flex-end;-ms-flex-align:flex-end;align-items:flex-end;display:-webkit-box;display:-webkit-flex;display:-ms-flexbox;display:flex;-webkit-flex-direction:row;-ms-flex-direction:row;flex-direction:row;-webkit-box-flex-wrap:wrap;-webkit-flex-wrap:wrap;-ms-flex-wrap:wrap;flex-wrap:wrap;-webkit-box-pack:center;-ms-flex-pack:center;-webkit-justify-content:center;justify-content:center;row-gap:0;text-align:center;max-width:671px;}@media (max-width: 1079px){.css-je19u9{max-width:400px;}.css-je19u9>span{white-space:pre;}}@media (max-width: 799px){.css-je19u9{max-width:400px;}.css-je19u9>span{white-space:pre;}} decide what to .css-1kiodld{max-height:56px;display:-webkit-box;display:-webkit-flex;display:-ms-flexbox;display:flex;-webkit-align-items:center;-webkit-box-align:center;-ms-flex-align:center;align-items:center;}@media (max-width: 1079px){.css-1kiodld{display:none;}} build next, decide what to build next, log in or sign up.

Get started for free

• Resources Home 🏠
• Try SciSpace Copilot
• Search research papers
• Add Copilot Extension
• Try AI Detector
• Try Paraphraser
• Try Citation Generator
• April Papers
• June Papers
• July Papers

How to Write an Introduction for a Research Paper

Table of Contents

Writing an introduction for a research paper is a critical element of your paper, but it can seem challenging to encapsulate enormous amount of information into a concise form. The introduction of your research paper sets the tone for your research and provides the context for your study. In this article, we will guide you through the process of writing an effective introduction that grabs the reader's attention and captures the essence of your research paper.

Understanding the Purpose of a Research Paper Introduction

The introduction acts as a road map for your research paper, guiding the reader through the main ideas and arguments. The purpose of the introduction is to present your research topic to the readers and provide a rationale for why your study is relevant. It helps the reader locate your research and its relevance in the broader field of related scientific explorations. Additionally, the introduction should inform the reader about the objectives and scope of your study, giving them an overview of what to expect in the paper. By including a comprehensive introduction, you establish your credibility as an author and convince the reader that your research is worth their time and attention.

Key Elements to Include in Your Introduction

When writing your research paper introduction, there are several key elements you should include to ensure it is comprehensive and informative.

• A hook or attention-grabbing statement to capture the reader's interest.  It can be a thought-provoking question, a surprising statistic, or a compelling anecdote that relates to your research topic.
• A brief overview of the research topic and its significance. By highlighting the gap in existing knowledge or the problem your research aims to address, you create a compelling case for the relevance of your study.
• A clear research question or problem statement. This serves as the foundation of your research and guides the reader in understanding the unique focus of your study. It should be concise, specific, and clearly articulated.
• An outline of the paper's structure and main arguments, to help the readers navigate through the paper with ease.

Preparing to Write Your Introduction

Before diving into writing your introduction, it is essential to prepare adequately. This involves 3 important steps:

• Conducting Preliminary Research: Immerse yourself in the existing literature to develop a clear research question and position your study within the academic discourse.
• Identifying Your Thesis Statement: Define a specific, focused, and debatable thesis statement, serving as a roadmap for your paper.
• Considering Broader Context: Reflect on the significance of your research within your field, understanding its potential impact and contribution.

By engaging in these preparatory steps, you can ensure that your introduction is well-informed, focused, and sets the stage for a compelling research paper.

Structuring Your Introduction

Now that you have prepared yourself to tackle the introduction, it's time to structure it effectively. A well-structured introduction will engage the reader from the beginning and provide a logical flow to your research paper.

Starting with a Hook

Begin your introduction with an attention-grabbing hook that captivates the reader's interest. This hook serves as a way to make your introduction more engaging and compelling. For example, if you are writing a research paper on the impact of climate change on biodiversity, you could start your introduction with a statistic about the number of species that have gone extinct due to climate change. This will immediately grab the reader's attention and make them realize the urgency and importance of the topic.

Introducing Your Topic

Provide a brief overview, which should give the reader a general understanding of the subject matter and its significance. Explain the importance of the topic and its relevance to the field. This will help the reader understand why your research is significant and why they should continue reading. Continuing with the example of climate change and biodiversity, you could explain how climate change is one of the greatest threats to global biodiversity, how it affects ecosystems, and the potential consequences for both wildlife and human populations. By providing this context, you are setting the stage for the rest of your research paper and helping the reader understand the importance of your study.

Presenting Your Thesis Statement

The thesis statement should directly address your research question and provide a preview of the main arguments or findings discussed in your paper. Make sure your thesis statement is clear, concise, and well-supported by the evidence you will present in your research paper. By presenting a strong and focused thesis statement, you are providing the reader with the information they could anticipate in your research paper. This will help them understand the purpose and scope of your study and will make them more inclined to continue reading.

Writing Techniques for an Effective Introduction

When crafting an introduction, it is crucial to pay attention to the finer details that can elevate your writing to the next level. By utilizing specific writing techniques, you can captivate your readers and draw them into your research journey.

Using Clear and Concise Language

One of the most important writing techniques to employ in your introduction is the use of clear and concise language. By choosing your words carefully, you can effectively convey your ideas to the reader. It is essential to avoid using jargon or complex terminology that may confuse or alienate your audience. Instead, focus on communicating your research in a straightforward manner to ensure that your introduction is accessible to both experts in your field and those who may be new to the topic. This approach allows you to engage a broader audience and make your research more inclusive.

Establishing the Relevance of Your Research

One way to establish the relevance of your research is by highlighting how it fills a gap in the existing literature. Explain how your study addresses a significant research question that has not been adequately explored. By doing this, you demonstrate that your research is not only unique but also contributes to the broader knowledge in your field. Furthermore, it is important to emphasize the potential impact of your research. Whether it is advancing scientific understanding, informing policy decisions, or improving practical applications, make it clear to the reader how your study can make a difference.

By employing these two writing techniques in your introduction, you can effectively engage your readers. Take your time to craft an introduction that is both informative and captivating, leaving your readers eager to delve deeper into your research.

Revising and Polishing Your Introduction

Once you have written your introduction, it is crucial to revise and polish it to ensure that it effectively sets the stage for your research paper.

Self-Editing Techniques

Review your introduction for clarity, coherence, and logical flow. Ensure each paragraph introduces a new idea or argument with smooth transitions.

Check for grammatical errors, spelling mistakes, and awkward sentence structures.

Ensure that your introduction aligns with the overall tone and style of your research paper.

Seeking Feedback for Improvement

Consider seeking feedback from peers, colleagues, or your instructor. They can provide valuable insights and suggestions for improving your introduction. Be open to constructive criticism and use it to refine your introduction and make it more compelling for the reader.

Writing an introduction for a research paper requires careful thought and planning. By understanding the purpose of the introduction, preparing adequately, structuring effectively, and employing writing techniques, you can create an engaging and informative introduction for your research. Remember to revise and polish your introduction to ensure that it accurately represents the main ideas and arguments in your research paper. With a well-crafted introduction, you will capture the reader's attention and keep them inclined to your paper.

Suggested Reads

ResearchGPT: A Custom GPT for Researchers and Scientists Best Academic Search Engines [2023] How To Humanize AI Text In Scientific Articles Elevate Your Writing Game With AI Grammar Checker Tools

You might also like

Smallpdf vs SciSpace: Which ChatPDF is Right for You?

ChatPDF Showdown: SciSpace Chat PDF vs. Adobe PDF Reader

Boosting Citations: A Comparative Analysis of Graphical Abstract vs. Video Abstract

Ertugrul Portakal

Apr 12, 2024

Writing a Research Paper Introduction (with 3 Examples)

Nail your research paper's introduction! Learn to captivate and inform readers from the start—our guide shows how!

TABLE OF CONTENTS

A catchy and informative introduction is essential in academic writing, especially if you want your readers to have background information about your paper. However, writing an interesting and informative introduction can sometimes be a time-consuming and tiring process. If you don't know where to start when crafting an introduction, no need to worry - we've got you covered!

In this article, we will explain step by step what an introduction is in academic writing and how to write it!

Ready? Let's start!

• An introduction is a paragraph that provides information about your entire paper and aims to attract and inform the reader.
• Before writing an introduction or even starting your paper, you need to research academic sources.
• The first one or two sentences of an introduction paragraph should be a hook to attract the reader's attention.
• Afterwards, you need to prepare the reader for your argument by giving background information about your topic.
• Finally, you should state your argument about your topic with a thesis statement.
• If you are writing a longer paper, you can inform your readers about the map of your paper.
• If you are looking for an AI assistant to support you throughout your writing process, TextCortex is designed for you with its advanced features.

What is an Introduction in a research paper?

In any academic writing, including essays and research papers, an introduction is the first paragraph that the reader will encounter. This paragraph should both attract the reader's attention and give them the necessary information about the paper. In any academic paper, the introduction paragraph constitutes 10% of the paper's total word count. For example, if you are preparing a 3,000-word paper, your introduction paragraph should consist of approximately 300 words. You should also write sentences within these 300 words that will attract the reader's attention and provide them with information about the paper.

Importance of an Introduction Paragraph

The biggest function of an introduction paragraph is to prepare the reader for the author's thesis statement. A traditional introduction paragraph begins with a few sentences or questions that will catch the reader's attention. After attracting the reader's attention, necessary background information on the subject is given. Finally, the author explains to the readers what the whole paper is about by stating the thesis. A thesis statement is the final sentence that summarizes the main points of your paper and conveys your claim.

First Things First: Preliminary Research

When working on any academic writing type, it is essential to start by researching your topic thoroughly before beginning to type. What sets academic writing apart from other writing types is the requirement for it to be written using accurate information from reliable sources.

Researching academic sources can be a time-consuming and unnecessary process. One has to read through hundreds of pages, review dozens of articles and verify the accuracy of each source. However, if you're looking to reduce your workload and maximize efficiency by automating repetitive tasks such as literature review, ZenoChat is the perfect solution for you. With its web search feature, ZenoChat can use the entire internet as a data source. Additionally, by activating the "scholar" option of the ZenoChat web search feature, you can ensure that it only uses academic sources when generating output.

How to Create an Introduction for Academic Writing?

Creating an introduction paragraph that is interesting, informative, and conveys your thesis is an easier process than it seems. As long as you have sufficient information about your topic and an outline , you can write engaging introductions by following a few simple steps. Let's take a closer look at how to write an introduction for academic writing.

1-) Start with a Catchy Hook

Your first sentence is one of the factors that most influence a reader's decision to read your paper. This sentence determines the tone of your paper and attracts the reader's attention. For this reason, we recommend that you start your introduction paragraph with a strong and catchy hook sentence.

• Avoid long and complex sentences
• Use clear and concise sentences
• Write a sentence that will spark the reader's curiosity
• You can ask questions that will encourage the reader to read the remaining paragraph
• Avoid fact or overly broad sentences
• Avoid using dictionary definitions as your hook

2-) Give Background Information

After writing a strong hook sentence, you need to provide basic information about your topic so that the reader can understand what they will learn about when they read your paper. In this section, you can benefit from opinions that support or oppose your argument. Additionally, this section should refer to the body paragraphs of your writing.

• You can write a background information sentence for each body paragraph.
• The information here should be concise and compact
• Avoid talking about your evidence and results unless necessary.

3-) State Your Thesis 

After attracting the reader's attention and providing background information, it is time to present your approach and argument towards the topic with a thesis statement. A thesis statement usually comprises one or two sentences and communicates the paper's argument to the reader. A well-written thesis statement should express your stance on the topic.

• Avoid merely stating a fact
• Claim your argument

4-) Tell Reader About Your Paper

Although you need to move on to body paragraphs after the thesis statement in short papers, it will be useful to add a few sentences that will guide the reader in your longer papers. This way, your readers can better understand which arguments they will encounter on which pages and the course of your paper. That leads the reader to clearly understand and follow your content.

Let’s Wrap it Up

Writing an interesting and informative introduction is usually a long process that requires a lot of rewriting. You may need to rewrite a sentence dozens of times so that your words and sentences clearly describe your paper and argument. Fortunately, you can generate state-of-the-art introductions using AI tools and use them with a little editing.

When it comes to text generation, paraphrasing, and grammar & spelling checking, TextCortex is the way to go with its advanced LLMs and customization options. With TextCortex, you can generate all writing types, including introduction, from scratch, rewrite your existing texts, change their tone of voice, or fix their grammar. TextCortex is available as a web application and browser extension. The TextCortex browser extension is integrated with 30,000+ websites and apps. So, you can complete your AI-driven writing tasks anywhere and anytime.

Let's examine a few sample introductions generated by TextCortex.

Example Introduction #1

“Should social media platforms be banned from collecting their users' data?”

Example Introduction #2

“Do electric vehicles decrease overall emissions?”

Example Introduction #3

“Is graffiti an act of vandalism or the creation of art?”

Reimagine the way you interact with AI.

Harness knowledge with an AI of your own, define behaviour and integrate your favorite tech stack on over 30,000 platforms.

Did you like this article? Explore a few more related posts.

How to Create a Strong Thesis?

Top 3 AI Tools That Write Essays (Free & Paid)

5 Main Essay Types & Guide with Examples

Questions  answers..

TextCortex is a powerful AI-powered writing tool that can help you reduce your writing time, handle big tasks, and create high-quality content without errors. With its customizable platform, personalized intelligence experience, advanced writing and research capabilities, and error-free content, TextCortex is the perfect tool for creative professionals who want to be a creative force in their industry.

Our AI copilot learned how to write from more than 3 billion sentences and has the ability to create unique content. However, fact-checking is something which still requires a human approval.

TextCortex supports more than 25 languages including English, Dutch, German, Ukranian, Romanian, Spanish, Portuguese, French, Italian.

Yes, TextCortex is completely free to use with all of its features. When you sign up, you receive 100 free creations. Then you will receive 20 recurring creations every day on the free plan.

Yes, we have a Text Generation API, please talk to us directly to implement it. You can reach out to us at [email protected]

Account sharing is not allowed. If you have a need for more than 5 seats for an account, you can directly contact us at [email protected]

Yes, TextCortex offers 14-day free trial for users to try out all features extensively with higher number of generations. But keep in mind that you can already try everything with the free plan. There is no feature that is locked behind a premium plan.

Overall, TextCortex AI has over 1000 five-star reviews on reputable review sites such as G2, Trustpilot and Capterra.

TextCortex learns and adapts to your unique writing style and knowledge, making it easier for you to write high-quality & personalized content.

Your premium features will be available until the end of your subscription date, then your account plan will be set to Free plan.

General Questions

Your ai copilot is ready to collaborate with you..

Connect your knowledge, customize the style and start collaborating with your AI copilot.

How to Write an Introduction For a Research Paper

Learn how to write a strong and efficient research paper introduction by following the suitable structure and avoiding typical errors.

An introduction to any type of paper is sometimes misunderstood as the beginning; yet, an introduction is actually intended to present your chosen subject to the audience in a way that makes it more appealing and leaves your readers thirsty for more information. After the title and abstract , your audience will read the introduction, thus it’s critical to get off to a solid start.  

This article includes instructions on how to write an introduction for a research paper that engages the reader in your research. You can produce a strong opening for your research paper if you stick to the format and a few basic principles.

What is An Introduction To a Research Paper?

An introduction is the opening section of a research paper and the section that a reader is likely to read first, in which the objective and goals of the subsequent writing are stated. 

The introduction serves numerous purposes. It provides context for your research, explains your topic and objectives, and provides an outline of the work. A solid introduction will establish the tone for the remainder of your paper, enticing readers to continue reading through the methodology , findings, and discussion. 

Even though introductions are generally presented at the beginning of a document, we must distinguish an introduction from the beginning of your research. An introduction, as the name implies, is supposed to introduce your subject without extending it. All relevant information and facts should be placed in the body and conclusion, not the introduction.

Structure Of An Introduction

Before explaining how to write an introduction for a research paper , it’s necessary to comprehend a structure that will make your introduction stronger and more straightforward.

A Good Hook

A hook is one of the most effective research introduction openers. A hook’s objective is to stimulate the reader’s interest to read the research paper.  There are various approaches you may take to generate a strong hook:  startling facts, a question, a brief overview, or even a quotation. 

Broad Overview

Following an excellent hook, you should present a wide overview of your major issue and some background information on your research. If you’re unsure about how to begin an essay introduction, the best approach is to offer a basic explanation of your topic before delving into specific issues. Simply said, you should begin with general information and then narrow it down to your relevant topics.

After offering some background information regarding your research’s main topic, go on to give readers a better understanding of what you’ll be covering throughout your research. In this section of your introduction, you should swiftly clarify your important topics in the sequence in which they will be addressed later, gradually introducing your thesis statement. You can use some  The following are some critical questions to address in this section of your introduction: Who? What? Where? When? How? And why is that?

Thesis Statement

The thesis statement, which must be stated in the beginning clause of your research since your entire research revolves around it, is the most important component of your research.

A thesis statement presents your audience with a quick overview of the research’s main assertion. In the body section of your work, your key argument is what you will expose or debate about it. An excellent thesis statement is usually very succinct, accurate, explicit, clear, and focused. Typically, your thesis should be at the conclusion of your introductory paragraph/section.

Tips for Writing a Strong Introduction

Aside from the good structure, here are a few tips to make your introduction strong and accurate:

• Keep in mind the aim of your research and make sure your introduction supports it.
• Use an appealing and relevant hook that catches the reader’s attention right away.
• Make it obvious to your readers what your stance is.
• Demonstrate your knowledge of your subject.
• Provide your readers with a road map to help them understand what you will address throughout the research.
• Be succinct – it is advised that your opening introduction consists of around 8-9 percent of the overall amount of words in your article (for example, 160 words for a 2000 words essay). 
• Make a strong and unambiguous thesis statement.
• Explain why the article is significant in 1-2 sentences.
• Remember to keep it interesting.

Mistakes to Avoid in Your Introduction

Check out what not to do and what to avoid now that you know the structure and how to write an introduction for a research paper .

• Lacking a feeling of direction or purpose.
• Giving out too much.
• Creating lengthy paragraphs.
• Excessive or insufficient background, literature, and theory.
• Including material that should be placed in the body and conclusion.
• Not writing enough or writing excessively.
• Using too many quotes.

Unleash the Power of Infographics with Mind the Graph

Do you believe your research is not efficient in communicating precisely or is not aesthetically appealing? Use the Mind The Graph tool to create great infographics and add more value to your research.

Related Articles

Subscribe to our newsletter

Exclusive high quality content about effective visual communication in science.

Sign Up for Free

Try the best infographic maker and promote your research with scientifically-accurate beautiful figures

no credit card required

About Jessica Abbadia

Jessica Abbadia is a lawyer that has been working in Digital Marketing since 2020, improving organic performance for apps and websites in various regions through ASO and SEO. Currently developing scientific and intellectual knowledge for the community's benefit. Jessica is an animal rights activist who enjoys reading and drinking strong coffee.

Content tags

Research Blog

How to write a research paper introduction (with examples).

I hope you enjoy reading this blog post.

If you would like to learn more about research, check out this  Research Course .

Welcome to our comprehensive guide on crafting the perfect introduction for your research paper. In this blog, we’ll explore the crucial elements of a strong introduction, highlight common pitfalls to avoid, and provide practical tips to effectively set the stage for your study’s objectives and significance. 

Table of Contents

Lack of a clear thesis statement, lack of clear objectives and scope, failure to establish the research significance, insufficient background information, inadequate literature review, ignoring the research gap, overly technical language, poor organization and flow, neglecting the audience, the importance of a good introduction.

A strong introduction sets the tone for the entire paper, guiding the reader through the research journey. It provides context, establishes relevance, and ensures the reader understands the importance of the study.

Starting a research project is exciting, but getting the introduction right is key. It’s like opening the door to your study and inviting readers in. However, there are some common missteps that can trip you up along the way.

Find the U.S. Research Position of your dreams!

Common mistakes to avoid.

A thesis statement is the central argument or claim that guides the entire research paper. It is a concise summary of the main point or claim of the paper and is typically found at the end of the introduction. A clear thesis statement helps to focus the research, provide direction, and inform the reader of the paper’s purpose. Expert reviewers may even skip the rest of the introduction (as they are well versed in the topic) and focus only on your thesis statement, so it’s vital to make sure it is perfect!

When a research introduction lacks a clear thesis statement, several issues can arise:

• Ambiguity : Without a clear thesis, the reader may be confused about the paper’s purpose and the main argument. Do not talk in vague terms. Whenever possible, use terminology established in recent literature. Narrow down the key aspects of the association that you are investigating (the study sample, the outcome and predictor measures) as much as possible.
• Lack of Focus : The paper can become unfocused and meander through unrelated topics, making it difficult for the reader to follow the argument. Do not try to have more than 1-2 main aims in a paper. Even if you have done supplementary analysis, it is better to say so in the discussion. As a rule of thumb, try to answer one major question only!
• Weak Argumentation : A well-defined thesis provides a strong foundation for building arguments. Without it, the arguments may appear weak and unsupported.

Let's be more practical:

1- In this paper, I will discuss climate change.

• Problem: This statement is too broad and vague. It does not provide a clear direction or specific argument.

2- This paper argues that climate change, measured by global average temperature change, is primarily driven by human activities, such as deforestation and the burning of fossil fuels, and proposes policy measures to mitigate its impact.(1)

• Strengths: – Specificity : It clearly states that the paper will focus on human activities as the main drivers of climate change. – Argument : It presents a specific claim that the paper will argue. – Direction : It hints at the structure of the paper by mentioning policy measures.

If you would like to learn more about introductions and other aspects of clinical research, check out the Medical Research Course from the Match Guy here .

Powerful Tips:

• Be Specific : Clearly define the main argument or claim. Avoid vague or broad statements.
• Be Concise : Keep the thesis statement concise, ideally one to two sentences.
• Provide Direction : Indicate the structure of the paper by hinting at the main points that will be discussed.
• Revise as Needed : Be prepared to revise the thesis statement as your research progresses and your understanding deepens.

Transform research ideas into published papers!

A clear statement of objectives and scope is crucial in a research paper introduction because it outlines what the study aims to achieve and defines the boundaries within which the research will be conducted.

Example of Lacking Clear Objectives and Scope: This paper examines the impacts of climate change on agriculture.

• Problem : This statement is too broad and vague. It does not specify what aspects of climate change or agriculture will be studied, nor does it define the geographical or temporal scope.

Example with Clear Objectives and Scope: This study aims to investigate the effects of rising temperatures and changing precipitation patterns on crop yields in the Midwest United States from 2000 to 2010. The objectives are to (1) assess the impact of temperature changes on corn and soybean yields, (2) analyze how variations in precipitation affect crop growth, and (3) identify adaptive strategies employed by farmers in the region.(2)

Powerful tips:

• Be Specific : Clearly state what the study aims to achieve and avoid vague or broad statements.
• Identify Key Areas : Outline the main areas or aspects that the research will focus on.
• Set Boundaries : Define the geographical, temporal, and conceptual boundaries of the research.
• List Objectives : Clearly articulate specific research objectives or questions that the study will address.
• Stay Realistic : Ensure that the objectives and scope are achievable within the constraints of the research project.
• Make it flow : Make sure you are not repeating the same concepts as the thesis statement, as these two sections are often presented back-to-back in the final paragraph of the introduction! Remember: the thesis statement is your hypothesis or question, and your objectives are ‘how’ you are going to test your thesis.

Master medical statistics and boost your productivity!

This mistake can result in the research appearing trivial or irrelevant, diminishing its potential impact. When the significance of the research is not well-established, readers may struggle to understand the value of the study and why they should care about it.

Example of Failure to Establish Research Significance: This study investigates the effects of social media usage on sleep patterns among teenagers.

• Problem : The significance of studying social media’s impact on sleep patterns is not explained. The reader may wonder why this research is important or what implications it has.

Example with Established Research Significance: This study investigates the effects of social media usage on sleep patterns among teenagers. Understanding this relationship is crucial because insufficient sleep is linked to numerous health issues, including decreased academic performance, heightened stress levels, and increased risk of mental health problems. With the pervasive use of social media among adolescents, identifying how it impacts sleep can inform strategies for promoting healthier habits and improving overall well-being in this vulnerable age group.(3)

• Link to Broader Issues : Connect the research topic to broader issues or trends that highlight its relevance and importance.
• Explain Practical Implications : Discuss the potential practical applications or benefits of the research findings.
• Address Gaps in Knowledge : Identify gaps in the existing literature that the research aims to fill.
• Highlight Potential Impact : Emphasize the potential impact of the research on the field, society, or specific populations.
• Use Concrete Examples : Provide concrete examples or scenarios to illustrate the significance of the research.

Feeling swamped by the complexities of Systematic Reviews?

Insufficient background information in the introduction of a research paper refers to failing to provide enough context for the reader to understand the research problem and its significance. Background information sets the stage for the research by offering necessary details about the topic, relevant theories, previous studies, and key terms.

This may lead to:

• Reader Confusion : Without adequate context, readers may struggle to understand the research question, its importance, and how it fits into the broader field of study.
• Weak Justification : Insufficient background can undermine the rationale for the research, making it difficult to justify why the study is necessary or valuable.
• Misinterpretation : Lack of context can lead to misinterpretation of the research objectives, methods, and findings.

Example of Insufficient Background Information: In recent years, many researchers have studied the effects of social media on teenagers. This paper explores the relationship between social media use and anxiety among teenagers.

• Problem : This introduction lacks specific details about the previous research, the theoretical framework, and key terms. It does not provide enough context for the reader to understand why the study is important.

Example of Adequate Background Information: Social media platforms have become an integral part of teenagers’ daily lives, with studies showing that 95% of teens have access to a smartphone and 45% are online almost constantly. Previous research has linked excessive social media use to various mental health issues, including anxiety and depression. However, the mechanisms underlying this relationship remain unclear. This paper explores the impact of social media use on anxiety levels among teenagers, focusing on the roles of social comparison and cyberbullying.(4)

If you would like to learn more about manuscript writing, check out the Comprehensive Research Course from the Match Guy here .

• Review Relevant Literature : Summarize key studies and theories related to your topic.
• Provide Context : Explain the broader context of your research problem.
• Define Key Terms : Ensure that any specialized terms or concepts are clearly defined.
• Identify the Research Gap : Highlight what is not yet known or understood about your topic.
• Be Concise : Provide enough information to set the stage without overwhelming the reader with details.

Getting No Replies from Institutions? Don't Stress!

This mistake can occur when the literature review is too brief, lacks depth, omits key studies, or fails to critically analyze previous work. An inadequate literature review can undermine the foundation of the research by failing to provide the necessary context and justification for the study.

Inadequate Literature Review: There has been some research on the relationship between exercise and mental health. This paper will investigate this relationship further.

• Problem : This review is too general and does not provide sufficient detail about the existing research or how it informs the current study.

Example with Adequate Literature Review: Research has consistently shown that regular physical activity has positive effects on mental health. For example, a study by Gujral et al. (2019) demonstrated that aerobic exercise can significantly reduce symptoms of depression and anxiety. Similarly, Smith and Lee (2020) found that strength training also contributes to improved mood and reduced stress levels. However, much of the existing research has focused on adult populations, with relatively few studies examining these effects in adolescents. Additionally, the specific types of exercise that are most beneficial for different mental health outcomes have not been thoroughly investigated. This study aims to explore the effects of various types of exercise on the mental health of high school students, thereby addressing these gaps in the literature.(5-6)

• Be Comprehensive : Review a broad range of studies related to the research topic to provide a thorough context.
• Be Specific : Cite specific studies, including their methodologies, findings, and relevance to the current research.
• Be Critical : Analyze and evaluate the existing research, identifying strengths, weaknesses, and gaps.
• Be Structured : Organize the literature review logically, grouping studies by themes or findings to create a coherent narrative.
• Be Relevant : Focus on the most relevant studies that directly relate to the research question and objectives.

Unlock your research potential with our dynamic course designed for medical students! Built by an experienced researcher with 150+ publications and 3000+ citations!

Ignoring the research gap in a research paper introduction means failing to identify and articulate what specific aspect of the topic has not been explored or adequately addressed in existing literature. The research gap is a critical component because it justifies the necessity and originality of the study. Without highlighting this gap, the research may appear redundant or lacking in significance.

How huge is this mistake?

• Lack of Justification : The study may not appear necessary or relevant, diminishing its perceived value.
• Redundancy : The research may seem to duplicate existing studies, offering no new insights or contributions to the field. Even if you are using methodology similar to previous studies, it is important to note why you are doing so e.g., few studies have used that specific methodology, and you would like to validate it in your sample population!
• Reader Disinterest : Readers may lose interest if they do not see the unique contribution or purpose of the research.

Example of Ignoring the Research Gap: Many studies have examined the effects of exercise on mental health. This paper looks at the relationship between physical activity and depression.

• Problem : This introduction does not specify what aspect of the relationship between physical activity and depression has not been studied, failing to highlight the unique contribution of the research.

Example of Identifying the Research Gap: Numerous studies have demonstrated the general benefits of physical activity on mental health, particularly its role in alleviating symptoms of depression. However, there is limited research on how different types of exercise (e.g., aerobic vs. anaerobic) specifically impact depression levels among various age groups. This study investigates the differential effects of aerobic and anaerobic exercise on depression in young adults, aiming to fill this gap in the literature.(6)

• Conduct a Thorough Literature Review : Understand the current state of research in your field to identify what has been studied and where gaps exist.
• Be Specific : Clearly articulate what specific aspect has not been covered in existing studies.
• Link to Your Study : Explain how your research will address this gap and contribute to the field.
• Use Evidence : Support your identification of the gap with references to previous studies.
• Emphasize Significance : Highlight why filling this gap is important for advancing knowledge or practical applications.

Do Statistical Analysis on your own with confidence in 2 weeks!

Overly technical language refers to the excessive use of jargon, complex terms, and highly specialized language that may be difficult for readers, especially those not familiar with the field, to understand. While technical language is sometimes necessary in academic writing, overusing it in the introduction can create several problems:

• Reader Alienation : Readers may find the text intimidating or inaccessible, leading to disengagement.
• Lack of Clarity : The main points and significance of the research can become obscured by complex terminology.
• Reduced Impact : The research may fail to communicate its importance effectively if readers struggle to understand the introduction.

Example of Overly Technical Language: The present study examines the metacognitive strategies employed by individuals in the domain of second language acquisition, specifically focusing on the interaction between declarative and procedural memory systems in the process of syntactic parsing.

• Problem : This sentence is loaded with jargon (“metacognitive strategies,” “second language acquisition,” “declarative and procedural memory systems,” “syntactic parsing”), which can be overwhelming and confusing for readers not familiar with these terms.

Example with Simplified Language: This study looks at the thinking strategies people use when learning a second language. It focuses on how different types of memory, such as the knowledge of facts and the skills for doing things, help in understanding sentence structures.(7)

• Know Your Audience : Tailor the language to the intended audience, ensuring it is accessible to both specialists and non-specialists.
• Define Term s: When technical terms are necessary, provide clear definitions or explanations.
• Use Analogies : Simplify complex concepts using analogies or examples that are easy to understand.
• Avoid Jargon : Limit the use of jargon and specialized terms, especially in the introduction.
• Seek Feedback : Ask peers or non-experts to read the introduction and provide feedback on clarity and accessibility.

Curious about delving into research but unsure where to begin?

Poor organization and flow in a research paper introduction refer to a lack of logical structure and coherence that makes the introduction difficult to follow. This can occur when ideas are presented in a haphazard manner, transitions between sections are weak or non-existent, and the overall narrative is disjointed. A well-organized introduction should smoothly guide the reader from the general context to the specific objectives of the study.

Example of Poor Organization and Flow: “Climate change affects agriculture in various ways. Many studies have looked at the impact on crop yields. This paper will discuss the economic implications of these changes. Climate models predict increased variability in weather patterns, which will affect water availability. Researchers have found that higher temperatures reduce the growing season for many crops.”

• Problem : The ideas are presented in a scattered manner without clear connections. The mention of economic implications seems out of place, and there are abrupt shifts between topics.

Example with Good Organization and Flow: Climate change poses significant challenges to agriculture by altering weather patterns, impacting crop yields, and affecting water availability. Numerous studies have shown that increased temperatures can shorten the growing season for many crops, leading to reduced yields. Additionally, climate models predict increased variability in weather patterns, which complicates water management for farmers. These changes not only affect food production but also have substantial economic implications for agricultural communities. This paper will examine the economic impacts of climate-induced changes in agriculture, focusing on crop yield variability and water resource management.(1)

• Create an Outline : Before writing, outline the main points you want to cover in the introduction.
• Think in terms of an inverted triangle : Begin broadly to introduce basic concepts related to your topic. As you progress through the introduction, you can introduce more and more specific topics until you have enough information to justify your thesis statement
• Use Transitional Phrases : Employ transitional phrases and sentences to connect ideas and sections smoothly.
• Follow a Logical Sequence : Present information in a logical order, moving from general context to specific objectives.
• Maintain Focus : Stay focused on the main topic and avoid introducing unrelated ideas.
• Revise for Coherence : Review and revise the introduction to ensure that it flows well and that each part contributes to the overall narrative.

Advisor UNLIMITED Access

We get how stressful the residency match process is, so we're here for you - communicate with your personal advisor ANYTIME you need!

Personal Statement Editing

Our editing includes not only language but also context, structure, and content advising.

ERAS Application Editing

The editing goes beyond language and grammar corrections to structure, design, and content based on your personal story and achievement.

• Interview Preparation

The best way to learn something is to do it. That’s why we divide our interview preparation sessions into two parts. Mock Interview + Feedback

Neglecting the audience refers to failing to consider the background, knowledge level, and interests of the intended readers when writing the introduction of a research paper. This mistake can manifest in several ways, such as using overly technical language for a general audience, providing insufficient background information for readers unfamiliar with the topic, or failing to engage the readers’ interest.

Example of Neglecting the Audience: For experts in genomic sequencing, this study explores the epigenetic modifications resulting from CRISPR-Cas9 interventions, focusing on the methylation patterns and histone modifications observed in gene-edited cells.

• Problem : This introduction assumes a high level of expertise in genomic sequencing and epigenetics, which may alienate readers without this background.

Example with Audience Consideration: CRISPR-Cas9 is a groundbreaking tool in genetic research that allows scientists to edit DNA with precision. However, altering genes can lead to unexpected changes in how genes are expressed, known as epigenetic modifications. This study investigates these changes by looking at specific markers on DNA, such as methylation patterns, and how they affect gene activity in cells that have been edited using CRISPR-Cas9. Our goal is to understand the broader implications of gene editing on cellular functions, which is crucial for advancing medical research and treatments.(8)

• Identify the Audience : Determine who the intended readers are (e.g., experts, students, general public) and tailor the language and content accordingly. Read papers from the journals you are considering for submission. Professional editors curate the language used in these papers and are a great starting point to identify the level of expertise of your audience!
• Simplify Language : Use clear and straightforward language, avoiding jargon and technical terms unless they are necessary and well-explained.
• Provide Background Information : Include sufficient background information to help readers understand the context and significance of the research.
• Engage the Reader : Start with an engaging introduction that highlights the relevance and importance of the research topic.
• Anticipate Questions : Consider what questions or concerns the audience might have and address them in the introduction

USMLE Tutoring

By following these guidelines and avoiding common pitfalls, you can create an introduction that not only grabs the attention of your readers but also sets the stage for a compelling and impactful research paper.

Final Tips:

• Revise and refine your introduction multiple times to ensure clarity and coherence.
• Seek feedback from peers, mentors, or advisors to identify areas for improvement.
• Keep your audience in mind and tailor your language and content to their needs and interests.
• Stay focused on your research objectives and ensure that every part of your introduction contributes to achieving them.
• Be confident in the significance of your research and its potential impact on your field or community.

Let your introduction be more than just words on a page. It’s a doorway to understanding. To help you along, we’ve created a practical course on writing and publishing research projects. It’s 100% risk-free, with a money-back guarantee if you’re not satisfied. Try it out now by clicking here .

Wishing you success on your research journey!

Marina Ramzy Mourid, Hamza Ibad, MBBS

Dr. Ibad graduated from the Aga Khan University Medical College and completed a post-doctoral research fellowship at Johns Hopkins in the Department of Radiology (Musculoskeletal Division). Dr. Ibad’s research and clinical interests include deep-learning applications for automated image interpretation, osteoarthritis, and sarcopenia-related health outcomes.

The Pathways for ECFMG Certification for MATCH 2025

2025 ERAS Application Updates 

General Surgery Residency Personal Statement Examples 

Emergency Medicine Residency Personal Statement Examples 

About thematchguy, become a researcher in the united states, interested in learning more about literature search with examples from published literature, the comprehensive research course, the systematic review course, the medical statistics course, how to find research positions in the us.

1. Abbass K, Qasim MZ, Song H, Murshed M, Mahmood H, Younis I. A review of the global climate change impacts, adaptation, and sustainable mitigation measures. Environ Sci Pollut Res. 2022;29(28):42539-42559. doi:10.1007/s11356-022-19718-6

2. Cai X, Wang D, Laurent R. Impact of climate change on crop yield: a case study of rainfed corn in central illinois. Journal of Applied Meteorology and Climatology. 2009;48(9):1868-1881. doi:10.1175/2009JAMC1880.1

3. Van Den Eijnden RJJM, Geurts SM, Ter Bogt TFM, Van Der Rijst VG, Koning IM. Social media use and adolescents’ sleep: a longitudinal study on the protective role of parental rules regarding internet use before sleep. IJERPH. 2021;18(3):1346. doi:10.3390/ijerph18031346

4. Schmitt, M. (2021). Effects of social media and technology on adolescents: What the evidence is showing and what we can do about it. Journal of Family and Consumer Sciences Education, 38(1), 51-59.

5. Gujral S, Aizenstein H, Reynolds CF, Butters MA, Erickson KI. Exercise effects on depression: Possible neural mechanisms. General Hospital Psychiatry. 2017;49:2-10. doi:10.1016/j.genhosppsych.2017.04.012

6. Smith PJ, Merwin RM. The role of exercise in management of mental health disorders: an integrative review. Annu Rev Med. 2021;72(1):45-62. doi:10.1146/annurev-med-060619-022943

7. Sun Q, Zhang LJ. Understanding learners’ metacognitive experiences in learning to write in English as a foreign language: A structural equation modeling approach. Front Psychol. 2022;13:986301. doi:10.3389/fpsyg.2022.986301

8. Kolanu ND. Crispr–cas9 gene editing: curing genetic diseases by inherited epigenetic modifications. Glob Med Genet. 2024;11(01):113-122. doi:10.1055/s-0044-1785234

How can we help you?

Leave your message here and we will get in touch with you as soon as possible.

Quick Links

• Our Reviews
• Our Podcast
• Residency Advising
• Personal Statement
• Match®Application Package
• P.O. Box 40388 Pittsburgh, PA 15201
• [email protected]
• + 1 412-295-8358
• Privacy Policy
• Terms & Conditions

WhatsApp Us

Join Over 20,000 Readers

An official website of the United States government

The .gov means it’s official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

• Publications
• Account settings
• My Bibliography
• Collections
• Citation manager

Save citation to file

Email citation, add to collections.

• Create a new collection
• Add to an existing collection

Add to My Bibliography

Your saved search, create a file for external citation management software, your rss feed.

• Search in PubMed
• Search in NLM Catalog
• Add to Search

How to Write an Effective Introduction

Affiliations.

• 1 Sydney Kimmel Medical College.
• 2 Rothman Institute, Philadelphia, PA.
• PMID: 30234565
• DOI: 10.1097/BSD.0000000000000714

Ideally, the Introduction is an essential attention grabbing section of a research paper. If written correctly, the Introduction peaks the reader's interest as well as serves as a roadmap for the rest of the paper. An effective Introduction builds off related empirical research and demonstrates a gap in which the current study fills. Finally, the Introduction proposes the research question(s) which will be answered in subsequent sections of the paper. A strong Introduction also requires the use of a simple and well-organized format as well as the avoidance of common pitfalls.

PubMed Disclaimer

Similar articles

• Scientific Medical Writing in Practice: the «IMR@D®» Format. Ben Saad H. Ben Saad H. Tunis Med. 2019 Mar;97(3):407-425. Tunis Med. 2019. PMID: 31729715
• WASP (Write a Scientific Paper): Miscellaneous practical and material aspects. Grech V. Grech V. Early Hum Dev. 2019 Jan;128:105-106. doi: 10.1016/j.earlhumdev.2018.09.008. Epub 2018 Sep 18. Early Hum Dev. 2019. PMID: 30241901
• How to write the methods section of a research paper. Kallet RH. Kallet RH. Respir Care. 2004 Oct;49(10):1229-32. Respir Care. 2004. PMID: 15447808
• Eight questions to ask before writing an article. Albert T. Albert T. Br J Hosp Med (Lond). 2017 Jun 2;78(6):341-343. doi: 10.12968/hmed.2017.78.6.341. Br J Hosp Med (Lond). 2017. PMID: 28614016 Review.
• Writing biomedical manuscripts part I: fundamentals and general rules. Ohwovoriole AE. Ohwovoriole AE. West Afr J Med. 2011 May-Jun;30(3):151-7. West Afr J Med. 2011. PMID: 22120477 Review.
• Essential Guide to Manuscript Writing for Academic Dummies: An Editor's Perspective. Aga SS, Nissar S. Aga SS, et al. Biochem Res Int. 2022 Sep 1;2022:1492058. doi: 10.1155/2022/1492058. eCollection 2022. Biochem Res Int. 2022. PMID: 36092536 Free PMC article. Review.
• Search in MeSH

LinkOut - more resources

Full text sources.

• Ovid Technologies, Inc.
• Wolters Kluwer

Other Literature Sources

• scite Smart Citations

Miscellaneous

• NCI CPTAC Assay Portal

• Citation Manager

NCBI Literature Resources

MeSH PMC Bookshelf Disclaimer

The PubMed wordmark and PubMed logo are registered trademarks of the U.S. Department of Health and Human Services (HHS). Unauthorized use of these marks is strictly prohibited.

Organizing Academic Research Papers: 4. The Introduction

• Purpose of Guide
• Design Flaws to Avoid
• Glossary of Research Terms
• Narrowing a Topic Idea
• Broadening a Topic Idea
• Extending the Timeliness of a Topic Idea
• Academic Writing Style
• Choosing a Title
• Making an Outline
• Paragraph Development
• Executive Summary
• Background Information
• The Research Problem/Question
• Theoretical Framework
• Citation Tracking
• Content Alert Services
• Evaluating Sources
• Primary Sources
• Secondary Sources
• Tertiary Sources
• What Is Scholarly vs. Popular?
• Qualitative Methods
• Quantitative Methods
• Using Non-Textual Elements
• Limitations of the Study
• Common Grammar Mistakes
• Avoiding Plagiarism
• Footnotes or Endnotes?
• Further Readings
• Annotated Bibliography
• Dealing with Nervousness
• Using Visual Aids
• Grading Someone Else's Paper
• How to Manage Group Projects
• Multiple Book Review Essay
• Reviewing Collected Essays
• About Informed Consent
• Writing Field Notes
• Writing a Policy Memo
• Writing a Research Proposal
• Acknowledgements

The introduction serves the purpose of leading the reader from a general subject area to a particular field of research. It establishes the context of the research being conducted by summarizing current understanding and background information about the topic, stating the purpose of the work in the form of the hypothesis, question, or research problem, briefly explaining your rationale, methodological approach, highlighting the potential outcomes your study can reveal, and describing the remaining structure of the paper.

Key Elements of the Research Proposal. Prepared under the direction of the Superintendent and by the 2010 Curriculum Design and Writing Team. Baltimore County Public Schools.

Importance of a Good Introduction

Think of the introduction as a mental road map that must answer for the reader these four questions:

• What was I studying?
• Why was this topic important to investigate?
• What did we know about this topic before I did this study?
• How will this study advance our knowledge?

A well-written introduction is important because, quite simply, you never get a second chance to make a good first impression. The opening paragraph of your paper will provide your readers with their initial impressions about the logic of your argument, your writing style, the overall quality of your research, and, ultimately, the validity of your findings and conclusions. A vague, disorganized, or error-filled introduction will create a negative impression, whereas, a concise, engaging, and well-written introduction will start your readers off thinking highly of your analytical skills, your writing style, and your research approach.

Introductions . The Writing Center. University of North Carolina.

Structure and Writing Style

I. Structure and Approach

The introduction is the broad beginning of the paper that answers three important questions for the reader:

• What is this?
• Why am I reading it?
• What do you want me to think about / consider doing / react to?

Think of the structure of the introduction as an inverted triangle of information. Organize the information so as to present the more general aspects of the topic early in the introduction, then narrow toward the more specific topical information that provides context, finally arriving at your statement of purpose and rationale and, whenever possible, the potential outcomes your study can reveal.

These are general phases associated with writing an introduction:

• Highlighting the importance of the topic, and/or
• Making general statements about the topic, and/or
• Presenting an overview on current research on the subject.
• Opposing an existing assumption, and/or
• Revealing a gap in existing research, and/or
• Formulating a research question or problem, and/or
• Continuing a disciplinary tradition.
• Stating the intent of your study,
• Outlining the key characteristics of your study,
• Describing important results, and
• Giving a brief overview of the structure of the paper.

NOTE: Even though the introduction is the first main section of a research paper, it is often useful to finish the introduction very late in the writing process because the structure of the paper, the reporting and analysis of results, and the conclusion will have been completed and it ensures that your introduction matches the overall structure of your paper.

II.  Delimitations of the Study

Delimitations refer to those characteristics that limit the scope and define the conceptual boundaries of your study . This is determined by the conscious exclusionary and inclusionary decisions you make about how to investigate the research problem. In other words, not only should you tell the reader what it is you are studying and why, but you must also acknowledge why you rejected alternative approaches that could have been used to examine the research problem.

Obviously, the first limiting step was the choice of research problem itself. However, implicit are other, related problems that could have been chosen but were rejected. These should be noted in the conclusion of your introduction.

Examples of delimitating choices would be:

• The key aims and objectives of your study,
• The research questions that you address,
• The variables of interest [i.e., the various factors and features of the phenomenon being studied],
• The method(s) of investigation, and
• Any relevant alternative theoretical frameworks that could have been adopted.

Review each of these decisions. You need to not only clearly establish what you intend to accomplish, but to also include a declaration of what the study does not intend to cover. In the latter case, your exclusionary decisions should be based upon criteria stated as, "not interesting"; "not directly relevant"; “too problematic because..."; "not feasible," and the like. Make this reasoning explicit!

NOTE: Delimitations refer to the initial choices made about the broader, overall design of your study and should not be confused with documenting the limitations of your study discovered after the research has been completed.

III. The Narrative Flow

Issues to keep in mind that will help the narrative flow in your introduction :

• Your introduction should clearly identify the subject area of interest . A simple strategy to follow is to use key words from your title in the first few sentences of the introduction. This will help focus the introduction on the topic at the appropriate level and ensures that you get to the primary subject matter quickly without losing focus, or discussing information that is too general.
• Establish context by providing a brief and balanced review of the pertinent published literature that is available on the subject. The key is to summarize for the reader what is known about the specific research problem before you did your analysis. This part of your introduction should not represent a comprehensive literature review but consists of a general review of the important, foundational research literature (with citations) that lays a foundation for understanding key elements of the research problem. See the drop-down tab for "Background Information" for types of contexts.
• Clearly state the hypothesis that you investigated . When you are first learning to write in this format it is okay, and actually preferable, to use a past statement like, "The purpose of this study was to...." or "We investigated three possible mechanisms to explain the...."
• Why did you choose this kind of research study or design? Provide a clear statement of the rationale for your approach to the problem studied. This will usually follow your statement of purpose in the last paragraph of the introduction.

IV. Engaging the Reader

The overarching goal of your introduction is to make your readers want to read your paper. The introduction should grab your reader's attention. Strategies for doing this can be to:

• Open with a compelling story,
• Include a strong quotation or a vivid, perhaps unexpected anecdote,
• Pose a provocative or thought-provoking question,
• Describe a puzzling scenario or incongruity, or
• Cite a stirring example or case study that illustrates why the research problem is important.

NOTE:   Only choose one strategy for engaging your readers; avoid giving an impression that your paper is more flash than substance.

Freedman, Leora  and Jerry Plotnick. Introductions and Conclusions . University College Writing Centre. University of Toronto; Introduction . The Structure, Format, Content, and Style of a Journal-Style Scientific Paper. Department of Biology. Bates College; Introductions . The Writing Center. University of North Carolina; Introductions . The Writer’s Handbook. Writing Center. University of Wisconsin, Madison; Introductions, Body Paragraphs, and Conclusions for an Argument Paper. The Writing Lab and The OWL. Purdue University; Resources for Writers: Introduction Strategies . Program in Writing and Humanistic Studies. Massachusetts Institute of Technology; Sharpling, Gerald. Writing an Introduction . Centre for Applied Linguistics, University of Warwick; Writing Your Introduction. Department of English Writing Guide. George Mason University.

Writing Tip

Avoid the "Dictionary" Introduction

Giving the dictionary definition of words related to the research problem may appear appropriate because it is important to define specific words or phrases with which readers may be unfamiliar. However, anyone can look a word up in the dictionary and a general dictionary is not a particularly authoritative source. It doesn't take into account the context of your topic and doesn't offer particularly detailed information. Also, placed in the context of a particular discipline, a term may have a different meaning than what is found in a general dictionary. If you feel that you must seek out an authoritative definition, try to find one that is from subject specific dictionaries or encyclopedias [e.g., if you are a sociology student, search for dictionaries of sociology].

Saba, Robert. The College Research Paper . Florida International University; Introductions . The Writing Center. University of North Carolina.

Another Writing Tip

When Do I Begin?

A common question asked at the start of any paper is, "where should I begin?" An equally important question to ask yourself is, "When do I begin?" Research problems in the social sciences rarely rest in isolation from the history of the issue being investigated. It is, therefore, important to lay a foundation for understanding the historical context underpinning the research problem. However, this information should be brief and succinct and begin at a point in time that best informs the reader of study's overall importance. For example, a study about coffee cultivation and export in West Africa as a key stimulus for local economic growth needs to describe the beginning of exporting coffee in the region and establishing why economic growth is important. You do not need to give a long historical explanation about coffee exportation in Africa. If a research problem demands a substantial exploration of historical context, do this in the literature review section; note in the introduction as part of your "roadmap" [see below] that you covering this in the literature review.

Yet Another Writing Tip

Always End with a Roadmap

The final paragraph or sentences of your introduction should forecast your main arguments and conclusions and provide a description of the rest of the paper [a "roadmap"] that let's the reader know where you are going and what to expect.

• << Previous: Executive Summary
• Next: Background Information >>
• Last Updated: Jul 18, 2023 11:58 AM
• URL: https://library.sacredheart.edu/c.php?g=29803
• QuickSearch
• Library Catalog
• Databases A-Z
• Publication Finder
• Course Reserves
• Citation Linker
• Digital Commons
• Our Website

Research Support

• Ask a Librarian
• Appointments
• Interlibrary Loan (ILL)
• Research Guides
• Databases by Subject
• Citation Help

Using the Library

• Reserve a Group Study Room
• Renew Books
• Honors Study Rooms
• Off-Campus Access
• Library Policies
• Library Technology

User Information

• Grad Students
• Online Students
• COVID-19 Updates
• Staff Directory
• News & Announcements
• Library Newsletter

My Accounts

• Interlibrary Loan
• Staff Site Login

FIND US ON  

• Interlibrary Loan and Scan & Deliver
• Course Reserves
• Purchase Request
• Collection Development & Maintenance
• Current Negotiations
• Ask a Librarian
• Instructor Support
• Library How-To
• Research Guides
• Research Support
• Study Rooms
• Research Rooms
• Partner Spaces
• Loanable Equipment
• Print, Scan, Copy
• 3D Printers
• Poster Printing
• OSULP Leadership
• Strategic Plan

Scholarly Articles: How can I tell?

• Journal Information
• Literature Review
• Author and affiliation

Introduction

• Specialized Vocabulary
• Methodology
• Research sponsors
• Peer-review

Most articles will start with an introductory section, which may be labeled introduction. This section introduces the research study, the thesis statement and why the research being conducted is important.

Questions to ask while you read:

• What is the thesis? What are the authors trying to prove or disprove?
• What is the contribution that the authors are making to the field?
• << Previous: Abstract
• Next: Specialized Vocabulary >>
• Last Updated: Apr 15, 2024 3:26 PM
• URL: https://guides.library.oregonstate.edu/ScholarlyArticle

Contact Info

121 The Valley Library Corvallis OR 97331–4501

Phone: 541-737-3331

Services for Persons with Disabilities

In the Valley Library

• Oregon State University Press
• Special Collections and Archives Research Center
• Undergrad Research & Writing Studio
• Graduate Student Commons
• Tutoring Services
• Northwest Art Collection

Digital Projects

• Oregon Explorer
• Oregon Digital
• ScholarsArchive@OSU
• Digital Publishing Initiatives
• Atlas of the Pacific Northwest
• Marilyn Potts Guin Library  
• Cascades Campus Library
• McDowell Library of Vet Medicine

• University of Michigan Library
• Research Guides

The Library Research Process, Step-by-Step

• Reading Scholarly Articles
• Finding & Exploring a Topic
• Finding Books
• Finding Articles
• Evaluating Sources
• Understanding & Using a Citation Style

Reading Scholarly Articles: Step-by-Step

1. Read the Abstract Section

The first step in reading a scholarly article is to read the abstract or summary of the article. Abstracts are always found at the beginning of an article and provide a basic summary or roadmap to the article. The abstract also introduces the purpose of the article.

Take a few minutes to carefully read the abstract of the practice article. Note that the abstract is not formally labeled "abstract" but is called "background and aims." Any summary at the start of an article is considered the abstract.

The abstract should always be read first to make sure the article is relevant to your topic. However, reading the abstract should never replace reading the entire article as the abstract is too brief to be used to fully understand the article.

2. Read the Conclusion Section Reading the conclusion will help you understand the main points of the article and what the authors are attempting to prove. 

3. Read the Introduction Section Now that you have an overview of the article from the abstract and understand the main points the authors are trying to prove from the conclusion, you will want to read the introduction.

4. Read the Results Section

Read the results section. Here are a couple of suggestions for deciphering results:

• If you are a visual learner, the charts may make sense to you.
• If charts are difficult to understand, look over the narrative and then return to the charts.
• Using the charts can help enhance your understanding of the narrative
• Look for works like "important" or "significant" and make special note of these phrases as these usually are signals from the author of an important result.

5. Read the Methods Section Reading the methods section will help you understand how the study or experiment was conducted. It is necessary for other researchers to understand the methods used so that they can replicate the study.

The methods section can also be difficult to read due to technical language used and density of the section. Try circling words, acronyms, and surveys you are unfamiliar with and look them up as those may be important to fully understand the article and may be necessary for future research. 

6. Read the Discussion & Limitations Section

The discussion section is where you will find the researcher's interpretation of the results. The author should answer the article's research question. Remember, you should evaluate the data to form your own conclusions. Don't just accept the author's conclusions without looking at the data for yourself.

Often authors will include a section detailing the limits to their research and their conclusions. The limitation section will usually explain conclusions that could not be drawn from the research as well as areas that future research is needed.

7. Read Through One More Time  After you have jumped around and read the different sections of the article, go back to the beginning and read the article in order. The article should be easier to read and make more sense as you will already be familiar with the main points in each section.

Watch: How to Read a Scholarly Article

Why Watch This Video? You'll learn essential strategies for reading scientific or scholarly journal articles, including:

• Identifying distinct sections (abstract, introduction, methods, results, discussion) and the purpose of those sections 
• How to effectively skim content using the ADIRM process (Abstract, Discussion, Introduction, Results, Methods), which will help you assess scholarly articles' relevance and validity
• Distinguishing between main points and less relevant sub points within scholarly research articles. 
• Learning about and applying these techniques will save you time and effort when working through your course assignments.

Frequently asked questions

What should i include in a research paper introduction.

The introduction of a research paper includes several key elements:

• A hook to catch the reader’s interest
• Relevant background on the topic
• Details of your research problem

and your problem statement

• A thesis statement or research question
• Sometimes an overview of the paper

Frequently asked questions: Writing a research paper

A research project is an academic, scientific, or professional undertaking to answer a research question . Research projects can take many forms, such as qualitative or quantitative , descriptive , longitudinal , experimental , or correlational . What kind of research approach you choose will depend on your topic.

The best way to remember the difference between a research plan and a research proposal is that they have fundamentally different audiences. A research plan helps you, the researcher, organize your thoughts. On the other hand, a dissertation proposal or research proposal aims to convince others (e.g., a supervisor, a funding body, or a dissertation committee) that your research topic is relevant and worthy of being conducted.

Formulating a main research question can be a difficult task. Overall, your question should contribute to solving the problem that you have defined in your problem statement .

However, it should also fulfill criteria in three main areas:

• Researchability
• Feasibility and specificity
• Relevance and originality

Research questions anchor your whole project, so it’s important to spend some time refining them.

In general, they should be:

• Focused and researchable
• Answerable using credible sources
• Complex and arguable
• Feasible and specific
• Relevant and original

All research questions should be:

• Focused on a single problem or issue
• Researchable using primary and/or secondary sources
• Feasible to answer within the timeframe and practical constraints
• Specific enough to answer thoroughly
• Complex enough to develop the answer over the space of a paper or thesis
• Relevant to your field of study and/or society more broadly

A research aim is a broad statement indicating the general purpose of your research project. It should appear in your introduction at the end of your problem statement , before your research objectives.

Research objectives are more specific than your research aim. They indicate the specific ways you’ll address the overarching aim.

Once you’ve decided on your research objectives , you need to explain them in your paper, at the end of your problem statement .

Keep your research objectives clear and concise, and use appropriate verbs to accurately convey the work that you will carry out for each one.

I will compare …

Your research objectives indicate how you’ll try to address your research problem and should be specific:

Research objectives describe what you intend your research project to accomplish.

They summarize the approach and purpose of the project and help to focus your research.

Your objectives should appear in the introduction of your research paper , at the end of your problem statement .

The main guidelines for formatting a paper in Chicago style are to:

• Use a standard font like 12 pt Times New Roman
• Use 1 inch margins or larger
• Apply double line spacing
• Indent every new paragraph ½ inch
• Include a title page
• Place page numbers in the top right or bottom center
• Cite your sources with author-date citations or Chicago footnotes
• Include a bibliography or reference list

To automatically generate accurate Chicago references, you can use Scribbr’s free Chicago reference generator .

The main guidelines for formatting a paper in MLA style are as follows:

• Use an easily readable font like 12 pt Times New Roman
• Set 1 inch page margins
• Include a four-line MLA heading on the first page
• Center the paper’s title
• Use title case capitalization for headings
• Cite your sources with MLA in-text citations
• List all sources cited on a Works Cited page at the end

To format a paper in APA Style , follow these guidelines:

• Use a standard font like 12 pt Times New Roman or 11 pt Arial
• If submitting for publication, insert a running head on every page
• Apply APA heading styles
• Cite your sources with APA in-text citations
• List all sources cited on a reference page at the end

No, it’s not appropriate to present new arguments or evidence in the conclusion . While you might be tempted to save a striking argument for last, research papers follow a more formal structure than this.

All your findings and arguments should be presented in the body of the text (more specifically in the results and discussion sections if you are following a scientific structure). The conclusion is meant to summarize and reflect on the evidence and arguments you have already presented, not introduce new ones.

The conclusion of a research paper has several key elements you should make sure to include:

• A restatement of the research problem
• A summary of your key arguments and/or findings
• A short discussion of the implications of your research

Don’t feel that you have to write the introduction first. The introduction is often one of the last parts of the research paper you’ll write, along with the conclusion.

This is because it can be easier to introduce your paper once you’ve already written the body ; you may not have the clearest idea of your arguments until you’ve written them, and things can change during the writing process .

The way you present your research problem in your introduction varies depending on the nature of your research paper . A research paper that presents a sustained argument will usually encapsulate this argument in a thesis statement .

A research paper designed to present the results of empirical research tends to present a research question that it seeks to answer. It may also include a hypothesis —a prediction that will be confirmed or disproved by your research.

Ask our team

Want to contact us directly? No problem.  We  are always here for you.

• Email [email protected]
• Start live chat
• Call +1 (510) 822-8066
• WhatsApp +31 20 261 6040

Our team helps students graduate by offering:

• A world-class citation generator
• Plagiarism Checker software powered by Turnitin
• Innovative Citation Checker software
• Professional proofreading services
• Over 300 helpful articles about academic writing, citing sources, plagiarism, and more

Scribbr specializes in editing study-related documents . We proofread:

• PhD dissertations
• Research proposals
• Personal statements
• Admission essays
• Motivation letters
• Reflection papers
• Journal articles
• Capstone projects

Scribbr’s Plagiarism Checker is powered by elements of Turnitin’s Similarity Checker , namely the plagiarism detection software and the Internet Archive and Premium Scholarly Publications content databases .

The add-on AI detector is powered by Scribbr’s proprietary software.

The Scribbr Citation Generator is developed using the open-source Citation Style Language (CSL) project and Frank Bennett’s citeproc-js . It’s the same technology used by dozens of other popular citation tools, including Mendeley and Zotero.

You can find all the citation styles and locales used in the Scribbr Citation Generator in our publicly accessible repository on Github .

• Subscribe to journal Subscribe
• Get new issue alerts Get alerts

Secondary Logo

Journal logo.

Colleague's E-mail is Invalid

Your message has been successfully sent to your colleague.

Save my selection

An Introduction to the Crossover Trial Design

Capili, Bernadette PhD, NP-C; Anastasi, Joyce K. PhD, DrNP, FAAN

Bernadette Capili is director of the Heilbrunn Family Center for Research Nursing at Rockefeller University, New York City, and Joyce K. Anastasi is the Independence Foundation Professor of Nursing and founding director of Special Studies in Symptom Management at New York University. This manuscript was supported in part by grant No. UL1TR001866 from the National Institutes of Health's National Center for Advancing Translational Sciences Clinical and Translational Science Awards Program. Contact author and column coordinator: Bernadette Capili, [email protected] . The authors have disclosed no potential conflicts of interest, financial or otherwise.

Editor's note: This is the 23rd article in a series on clinical research by nurses. The series is designed to be used as a resource for nurses to understand the concepts and principles essential to research. Each column will present the concepts that underpin evidence-based practice—from research design to data interpretation. To see all the articles in the series, go to https://links.lww.com/AJN/A204 .

Full Text Access for Subscribers:

Individual subscribers.

Institutional Users

Not a subscriber.

You can read the full text of this article if you:

• + Favorites
• View in Gallery

Readers Of this Article Also Read

Advocating for janetta, a case of bradycardia and extreme fatigue, a case of tachycardia and shortness of breath, a case of an asymptomatic woman after a fracture repair, ethical care for patients with self-managed abortion after roe.

• Research Guides
• Vanderbilt University Libraries
• Central Library

HART 1740W: Introduction to Design Studies - Worsnick

• Finding Books & Articles
• Getting Started With Research
• Related Resources
• Writing About Art
• Citing What You Find
• Evaluating Sources
• Interlibrary Loan & Scan and Deliver at Vanderbilt

What's This Number?

• How to Read a Call Number

Need help making sense of the Call # you found in Library Catalog?  or where to find the book in the library? 

Librarian for Art, History of Art and Architecture, and French & Italian

Books & Articles

• Finding Books

Vanderbilt University Library Search

Selecting the best search scope for your research needs:

Everything vs. Library Catalog vs. Articles

For a more detailed explanation of your search scope options consult What am I searching?

Keyword vs. Subject Searching

• << Previous: Getting Started With Research
• Next: Related Resources >>
• Last Updated: Aug 28, 2024 5:05 PM
• URL: https://researchguides.library.vanderbilt.edu/IntroDesignStudies-Worsnick

• Search Menu
• Sign in through your institution
• Chemical Biology and Nucleic Acid Chemistry
• Computational Biology
• Critical Reviews and Perspectives
• Data Resources and Analyses
• Gene Regulation, Chromatin and Epigenetics
• Genome Integrity, Repair and Replication
• Nucleic Acid Enzymes
• RNA and RNA-protein complexes
• Synthetic Biology and Bioengineering
• Molecular and Structural Biology
• Advance Articles
• Breakthrough Articles
• Molecular Biology Database Collection
• Special Collections
• Scope and Criteria for Consideration
• Author Guidelines
• Data Deposition Policy
• Database Issue Guidelines
• Web Server Issue Guidelines
• Submission Site
• About Nucleic Acids Research
• Editors & Editorial Board
• Information of Referees
• Self-Archiving Policy
• Dispatch Dates
• Advertising and Corporate Services
• Journals Career Network
• Journals on Oxford Academic
• Books on Oxford Academic

Article Contents

Introduction, materials and methods, data availability, supplementary data, acknowledgements.

• < Previous

DdrC, a unique DNA repair factor from D. radiodurans , senses and stabilizes DNA breaks through a novel lesion-recognition mechanism

• Article contents
• Figures & tables
• Supplementary Data

Robert Szabla, Mingyi Li, Victoria Warner, Yifeng Song, Murray Junop, DdrC, a unique DNA repair factor from D. radiodurans , senses and stabilizes DNA breaks through a novel lesion-recognition mechanism, Nucleic Acids Research , Volume 52, Issue 15, 27 August 2024, Pages 9282–9302, https://doi.org/10.1093/nar/gkae635

• Permissions Icon Permissions

The bacterium Deinococcus radiodurans is known to survive high doses of DNA damaging agents. This resistance is the result of robust antioxidant systems which protect efficient DNA repair mechanisms that are unique to Deinococcus species. The protein DdrC has been identified as an important component of this repair machinery. DdrC is known to bind to DNA in vitro and has been shown to circularize and compact DNA fragments. The mechanism and biological relevance of this activity is poorly understood. Here, we show that the DdrC homodimer is a lesion-sensing protein that binds to two single-strand (ss) or double-strand (ds) breaks. The immobilization of DNA breaks in pairs consequently leads to the circularization of linear DNA and the compaction of nicked DNA. The degree of compaction is directly proportional with the number of available nicks. Previously, the structure of the DdrC homodimer was solved in an unusual asymmetric conformation. Here, we solve the structure of DdrC under different crystallographic environments and confirm that the asymmetry is an endogenous feature of DdrC. We propose a dynamic structural mechanism where the asymmetry is necessary to trap a pair of lesions. We support this model with mutant disruption and computational modeling experiments.

The bacterium Deinococcus radiodurans , along with other species of the Deinococcus genus, are distinguished for their ability to survive high doses of DNA-damaging agents, such as UV-C radiation, ionizing radiation, and desiccation ( 1 , 2 ). Several factors have been proposed to contribute to the DNA-damage resistance phenotype. Most notably is the atypically high intracellular concentration of Mn 2+ -based antioxidant species, which protects the proteome from oxidative damage both enzymatically and non-enzymatically ( 3–5 ). Shielding of the proteome enables D. radiodurans to respond rapidly to DNA damage via extremely efficient DNA repair mechanisms ( 6 , 7 ).

The response mechanism begins with the activation of the Radiation-Desiccation Response (RDR) when the bacterium senses conditions that can lead to DNA damage ( 8 , 9 ). The RDR cascade triggers the upregulation of several proteins with established connections to DNA repair including RecA, UvrA/B, GyrA/B and SSB. Among the most highly upregulated genes are five Deinococcus-unique genes: ddrA, ddrB, ddrC, ddrD and pprA (ddr, DNA-damage response; ppr, pleiotropic protein promoting DNA repair) ( 10–14 ). With the exception of DdrA, these genes do not have any identifiable sequence homologs in species outside of the Deinococcus genus. This lack of homology prompted investigations into the function of each of these upregulated genes, as they may be Deinococcus -specific DNA repair factors. Interestingly, the protein products of all five genes have been found to interact directly with DNA and effect a variety of functions related to genome maintenance. PprA is a regulator of DNA Gyrase activity, ensuring the proper resolution of various DNA topologies that arise during DNA repair ( 15–17 ). DdrA is a distant homolog of eukaryotic Rad52 ( 18–20 ). DdrB binds to single-stranded (ss) DNA and promotes accurate single-strand annealing ( 21–23 ). DdrD also binds to ss-DNA, but its function is largely unknown ( 24 ).

Multiple DNA-related behaviors have been documented for DdrC. The protein has been observed to bind to both ss- and ds-DNA ( 25 ). When bound to ss-DNA, DdrC can promote the annealing of complimentary DNA strands. When bound to ds-DNA, DdrC has been observed to circularize linear DNA, and to condense plasmids into compact shapes. Currently, it is unclear how DdrC accomplishes these various functions, nor which of these functions are biologically relevant.

In this study, we show that DdrC compacts circular dsDNA through specific interactions with ss-breaks. We demonstrate that each DdrC dimer binds to and immobilizes two ss-breaks relative to one another. DNA compaction then emerges as a consequence of trapping pairs of lesions along a DNA fragment. We also show that DdrC recognizes and immobilizes pairs of ds-breaks through an analogous break-trapping mechanism, the consequence of which is the circularization of linear DNA.

During the preparation of this manuscript, a crystal structure of DdrC was published, revealing that DdrC exists as a homodimer ( 26 ). Curiously, the structure of the DdrC homodimer is in an asymmetric conformation, where one DdrC monomer is in a different conformation from the other. This is highly unusual, as homo-oligomers of proteins typically assemble into symmetric assemblies. From the DdrC crystal structure alone, it is unclear whether the dimer asymmetry is an evolved feature or if it is a crystallographic artifact. In this study, we solved the structure of the DdrC dimer under different crystallographic environments and still observed the same asymmetric structure, indicating that dimer asymmetry is in fact an endogenous feature of DdrC.

We propose a structural mechanism where the DdrC dimer scans for and identifies DNA lesions through mechanical deformations of the DNA. In this model, the asymmetry of DdrC is an essential part of the lesion scanning process.

Recombinant protein expression and purification

The ORF sequence of ddrC from D. radiodurans (Uniprot #Q9RYE6) was codon-optimized for E. coli expression, synthesized with flanking attB recombination sites, and then blunt-end subcloned into pUC57-Kan to generate a Gateway-compatible entry clone ( Supplementary Figure S12 ). Appropriate mutations were introduced by site-directed mutagenesis (SDM), while domain deletions were introduced by PCR, followed by Gateway BP cloning into pDONR-201 (Invitrogen). The DdrC variants were then cloned into publicly available E. coli expression vectors by Gateway LR cloning. A custom Gateway pDEST vector that introduces an N-terminal His 14 -mOCR fusion tag (pDEST-SHmOCR) was created for the expression of ΔNTD DdrC and deposited to Addgene (plasmid #206874). Details and creation histories for all plasmids used in this study are summarized in Supplementary Table S1 .

Selenomethionine-derivatized (SeMet) DdrC variants were expressed from their corresponding expression plasmids ( Supplementary Table S3 ) in the methionine-auxotrophic strain E. coli B834(DE3) (Novagen, Madison, WI, USA). DdrC protein was derivatized with selenium during protein expression using the M9 SeMet high-yield media kit as per the manufacturer's protocol (Medicilon, Shanghai, China). Non-derivatized DdrC variants were expressed from their corresponding expression plasmids ( Supplementary Table S3 ) in Escherichia coli BL21(DE3) by growing transformed bacteria in LB media at 37°C to an OD 600 between 0.4 and 0.7. Once the desired cell density was reached, cells were cooled on ice for 20 min, then IPTG was added to the media at a final concentration of 1 mM to stimulate protein production. The bacterial culture was then grown at 16°C for an additional 16 hours.

All downstream purification was performed at 4°C or on ice. For all DdrC variants except ΔNTD DdrC, the bacterial cells were harvested from culture by centrifugation, then washed and resuspended in Buffer A (800 mM NaCl, 5% (v/v) glycerol, 20 mM Tris, pH 8.0) at a final cell density of ∼0.1 g cells/ml. The cell suspension was then lysed by French press in the presence of protease inhibitors (1 mM Benzamidine, 1 mM PMSF, 300 nM Aprotinin, 10 μM Leupeptin, 1 μM Pepstatin A), then clarified by centrifugation at 48,000xg and filtered through a 0.45 μm PES filter. The soluble lysate was applied to a Proteindex EDTA resistant Ni-IMAC column (Marvelgent Biosciences Inc.) and washed with 40 column-volumes (CV) of Buffer A and 40 CV of 6 mM imidazole in Buffer A prior to eluting DdrC with 210 mM imidazole in Buffer A. To remove the N-terminal affinity tag, DdrC was exchanged into Buffer K (200 mM Na 2 SO 4 , 20 mM Na 3 Citrate/Citric Acid, pH 6.5) using a HiPrep 26/10 desalting column (Cytiva, LLC), then incubated with His-tagged TEV protease for 16 hours at a 1:15 TEV:DdrC molar ratio. To prevent ionic column interactions, 2 M NaCl dissolved in Buffer A was slowly added to the reaction mixture until a final NaCl concentration of 600 mM was reached. Untagged DdrC was then isolated from the reaction mixture by passing the solution over an equilibrated Ni-IMAC column, collecting the flow-through, and exchanging the protein into Buffer K. Finally, DdrC was concentrated in Buffer K using a 5 kDa MCO Vivaspin Turbo 15 PES concentrator (Sartorius AG) spun at 3000–4200×g in 10 min intervals until the desired DdrC concentration was reached ( Supplementary Table S3 ). Protein was aliquoted into single-use samples, flash-frozen, and stored at –80°C until needed. DdrC concentration was calculated from measured A 280nm values using the expected molar absorption coefficient for each DdrC variant. Purity profiles for each DdrC variant are available in Supplementary Figure S13 .

ΔNTD DdrC was purified the same way as other DdrC variants, except Buffer B (2 M NaCl, 5% (v/v) glycerol, 20 mM Tris, pH 8.0) was used in place of Buffer A and the Ni-IMAC column was washed longer, with lower concentrations of imidazole (0.45 mM for 40 CV and 0.9 mM for 40 CV). In addition, tag removal by TEV protease was done in Buffer C (50 mM KCl, 50 mM Tris pH 8.0, 0.5 mM EDTA) instead of Buffer K. Unlike the other DdrC variants, ΔNTD DdrC precipitated out of solution following tag cleavage, but the protein was readily re-solubilized by adding 2× Buffer B to the reaction mixture at a 1:1 volume ratio. Cleaved ΔNTD DdrC was then isolated, buffer exchanged, concentrated and stored the same way as all other DdrC variants.

The SNM1a nuclease was expressed and purified as previously described, then stored at 128 μM in SNM1a Storage Buffer (200 mM NaCl, 10 mM Tris pH 7.5, 5% glycerol, 0.5 mM TCEP) at –80°C ( 27 ).

Generating DNA ligands for binding studies

Short 22-bp nicked and un-nicked dsDNA fragments were generated by annealing complimentary DNA oligonucleotides together. Oligonucleotides MJ8616, MJ8617 and MJ8618 were annealed to generate the nicked DNA ligand, while MJ8631 and MJ8618 were annealed to generate the un-nicked DNA ligand ( Supplementary Table S2 ). Similarly, MJ8381 and MJ8383 were annealed together to generate a 48-bp dsDNA fragment ( Supplementary Table S2 ). Oligonucleotides were annealed by dissolving synthesized oligos in TE buffer (10 mM Tris, pH 8.0, 1 mM EDTA) and mixing them together at a final equimolar concentration of 5 μM. The mixture was then heated to 95°C and slowly cooled to 20°C at a rate of 0.5°C/min before aliquoting and storing the annealed DNA at –20°C.

Supercoiled (RFI) and randomly nicked (RFII) ΦX174 plasmid DNA was obtained directly from New England Biolabs (NEB). The supercoiled plasmid was digested with Nt.BspQI (NEB) and FD-Eco47I (Thermo Scientific) according to the enzyme manufacturer's protocols to generate single-nicked and linear ΦX174 DNA respectively.

Supercoiled pUC19 plasmid was isolated by midi-prep (Presto™ Midi Plasmid Kit, Geneaid) from a culture of transformed E. coli DH10B (Top10) that was grown to an OD 600 of 1.8. Mutant pUC19 lacking one of three BssSI sites was generated by site-directed mutagenesis (SDM) using primers MJ8482 and MJ8483 ( Supplementary Table S2 ), then verified by Sanger sequencing. Supercoiled mutant pUC19 was then generated using the same method as WT pUC19. Both WT and mutant pUC19 were digested with nicking endonucleases that introduce exactly 1, 2, 3 or 4 ss-breaks on pUC19. The nicks in the 2-nick pUC19 were then re-sealed with T4 DNA ligase to generate relaxed, unnicked pUC19 plasmid. All pUC19 plasmids were then linearized with either SalI or SacI blunt-end restriction endonucleases. After each reaction step, the enzymes were heat-inactivated, and the reaction mixture was sufficiently diluted to overcome buffer incompatibilities of downstream enzymes. Optimized reaction conditions for each enzymatic step are provided in Supplementary Figure S3 . To generate nicked dephosphorylated pUC19 plasmid, the 3-nick variant of pUC19 was digested with rSAP (NEB) according to the manufacturer's protocol, except at a variable ratio of 0.25–4 units of rSAP per μg of pUC19. The absence of terminal 5′ phosphates was verified by digestion of 2 nM pUC19 with 200 nM SNM1A exonuclease in Buffer F (75 mM potassium acetate, 10 mM magnesium acetate, 1 mM DTT, 0.1 mg/ml BSA, 50 mM Tris/acetate, pH 7.2) for 1 h at 37°C ( Supplementary Figure S2 ).

All ΦX174 and pUC19 plasmid ligands destined for DdrC binding assays were diluted with TE buffer to a final DNA concentration of 35 ng/μl, then aliquoted and stored at –20°C. DNA concentration was calculated from A260 measurements (Nanodrop 2000c, Thermo Scientific).

Electrophoretic mobility shift assay

All EMSA mixtures were set up and incubated at 4°C. First, DdrC was serially diluted from storage conditions with Buffer K (200 mM Na 2 SO 4 , 20 mM Na 3 Citrate/Citric Acid, pH 6.5) to 2× of the final desired protein concentration. The 2× DdrC solutions were then diluted to 1× with DNA and other buffer components to yield a final reaction mixture of DdrC in Buffer M (100 mM Na 2 SO 4 , 1 mM MgCl 2 , 0.1 mg/ml BSA, 20 mM Na 3 citrate/citric acid, pH 6.5) with either 2 nM of plasmid DNA or 100 nM of annealed DNA oligonucleotide. The EMSA reaction mixtures were then incubated for 60 min to allow DdrC to bind DNA. For the Proteinase K control, Proteinase K was then added to a final concentration of 0.2 mg/ml and incubated at 37°C for 10 min to digest DdrC. The reaction mixtures were then mixed with 6x DNA loading dye (0.025% w/v Bromophenol Blue, 30% v/v Glycerol) to a 1× final concentration. For the plasmid-based assays, 6 μl of the mixtures (10 fmol plasmid DNA) were run on a 1% w/v agarose gel in a low-pH TAE buffer (40 mM Tris, 44 mM acetic acid, 1 mM EDTA, pH 6.0) at a field strength of 4 V/cm for 2–3 h at 4°C. For the annealed oligonucleotide-based assays, 12 μl of the mixtures (1 pmol DNA) were run on a 10% native PAGE gel in the low-pH TAE buffer at a field strength of 15 V/cm for 50 min at room temperature. All gels were stained with ethidium bromide.

EMSA gels were quantified by integrating the band intensities corresponding to unbound DNA ( ⁠|${{I}_{UB}}$|⁠ ), High-affinity complex ( ⁠|${{I}_{HA}}$|⁠ ) and Low-affinity complex ( ⁠|${{I}_{LA}}$|⁠ ) in each gel lane using Image Lab software (Bio-Rad Laboratories, Inc.). The integration ranges for |${{I}_{UB}}$|⁠ , |${{I}_{HA}}$| and |${{I}_{LA}}$| were different for each DNA ligand used ( Supplementary Figure S14 ). In some cases, the signal corresponding to the UB species bleeds into the range that is integrated as the HA species due to limitations in gel resolution. This results in some proportion of the |${{I}_{UB}}$| signal being falsely integrated as |${{I}_{HA}}$|⁠ . The exact proportion of |${{I}_{UB}}$| that is falsely integrated can be calculated from the ratio of |${{I}_{HA}}$| to |${{I}_{UB}}$| signal in the 0 nM DdrC sample ( ⁠|$I_{HA}^0/I_{UB}^0$|⁠ ) since all integrated intensity in this sample must correspond to unbound DNA. The corrected |${{I}_{HA}}$| signal ( ⁠|$I_{HA}^{Corr}$|⁠ ) was therefore calculated as follows:

The LA signal must also be corrected due to a gel staining artifact where the regions near gel wells have a higher background intensity from the rest of the gel, resulting in an inflated |${{I}_{LA}}$| signal. In this case, the proportion of total DNA signal ( ⁠|${{I}_{HA}} + {{I}_{LA}} + {{I}_{UB}}$|⁠ ) being falsely integrated as |${{I}_{LA}}$| can be calculated from the ratio of |${{I}_{HA}}$| to |${{I}_{Total}}$| signal in the 0 nM DdrC sample ( ⁠|$I_{LA}^0/( {I_{HA}^0 + I_{LA}^0 + I_{UB}^0} )$|⁠ ). The corrected |${{I}_{LA}}$| signal ( ⁠|$I_{LA}^{Corr}$|⁠ ) was therefore calculated as follows:

Finally, the corrected intensities were used to calculate the proportion of DNA that is bound in the HA state and the LA state:

Nuclease protection assay

First, DdrC or PprA protein was serially diluted from storage conditions with Buffer K (200 mM Na 2 SO 4 , 20 mM Na 3 citrate/citric acid, pH 6.5) to 4x of the final desired protein concentration. Nicked or linear pUC19 plasmid and other buffer components were added to the protein dilutions to yield 1× DdrC or PprA with 2 nM pUC19 in a buffered background of 1× Buffer M (100 mM Na 2 SO 4 , 1 mM MgCl 2 , 0.1 mg/ml BSA, 20 mM Na 3 citrate/citric acid, pH 6.5) and 1× Buffer F (75mM potassium acetate, 10 mM magnesium acetate, 1 mM DTT, 0.1 mg/ml BSA, 50 mM Tris/acetate, pH 7.2). The mixtures were incubated at 4°C for 1 h to allow for protein–DNA complex formation. Then, either SNM1a or BglI (Fast-Digest, Thermo Scientific) were added to the mixtures at final concentrations of 200 nM for SNM1a and 0.05U/μl for BglI from 10×-concentrated stock solutions. The nuclease reactions were incubated at 37°C for 1 h. Proteinase K was then added at a final concentration of 0.2 mg/ml and incubated at 37°C for 10 min to digest the nucleases, DdrC and PprA. Finally, the reaction mixtures were loaded and run on an agarose gel as described in the ‘Electrophoretic mobility shift assay methods’ section.

Differential scanning fluorimetry

To optimize buffer conditions for DdrC stability, a solution of 2x SYPRO ORANGE dye (Protein Thermal Shift™ Dye Kit, Applied Biosystems) and 175 μM WT DdrC was prepared in Buffer A (800 mM NaCl, 5% (v/v) Glycerol, 20 mM Tris, pH 8.0). The protein-dye solution was mixed at a 1:1 volume ratio with various ionic salt or buffered pH solutions in a 96-well qPCR plate (Durham Salt and pH Screens, Molecular Dimensions). All mixtures were prepared and kept at 4°C. Fluorescence in each well was monitored at 520/558 nm on a qPCR thermocycler (QuantStudio™ 3, Applied Biosystems) as the temperature was increased from 12°C to 99°C at a rate of 0.05°C/s. To identify the melting temperatures ( ⁠|${{T}_m}$|⁠ ) for each sample, signal fluctuations were first smoothed using the Protein Thermal Shift Software (Applied Biosystems), resulting in useable |$F( T )$| curves. |${{T}_m}$| values were then calculated by identifying all positive peaks of |$dF/dT$| using the SciPy signal processing library in Python ( 28 ).

To assay the relative stabilities of different DdrC variants, a solution of 2× SYPRO Orange Dye in Buffer K was mixed at a 1:1 volume ratio with 175 μM of each DdrC variant in Buffer K. The thermal melt profile of each DdrC variant was then measured and analyzed the same way as for the buffer optimization assays.

To measure the oligomeric state of DdrC, 100 μl of each DdrC variant was injected directly from storage conditions ( Supplementary Table S3 ) onto a Superdex 200 Increase 10/300 GL size-exclusion column (SEC) using the ÄKTA Pure chromatography system (Cytiva, LLC) running Buffer K at 0.5 ml/min. Absolute molecular weight was determined by SEC-coupled multi-angle light scattering analysis (SEC-MALS). The size-exclusion column was connected in-line to a Dawn HELEOS II MALS detector equipped with a 662 nm laser source and an Optilab T-rEX differential refractometer with a 658 nm LED source (Wyatt Technology). Molecular weight was calculated by Zimm plot analysis using the ASTRA software (v6.1.5.22; Wyatt Technology).

Crystallization and X-ray diffraction

All protein crystals were grown by the hanging-drop vapor-diffusion method at 20°C. The recombinant DdrC proteins that were used for crystallization trials are summarized in Supplementary Table S3 . When screening for initial crystallization conditions, 1 μl of DdrC was mixed with 1 μl of varying precipitant solutions from different commercial screening kits. The mixed drop was suspended over 1 ml of an ammonium sulfate dehydrating solution in a sealed chamber. Conditions that yielded DdrC crystals were optimized for X-ray diffraction quality by varying: the initial DdrC concentration, the volume ratio of protein solution to precipitant solution, and the composition of the dehydrating solution. In some cases, optimized crystallization conditions were further subjected to secondary screens of additive solutions to improve crystal quality. Final crystallization conditions of the three deposited DdrC structures (PDB 7UDI, 8U0G and 8U1J) are summarized in Supplementary Table S4 .

Crystals were harvested with nylon cryo-loops and flash-frozen in liquid nitrogen. Then, crystals were mounted in a nitrogen cryo-stream at 100K during data collection. X-ray diffraction data was collected from both synchrotron and Cu K-α rotating anode radiation sources. Synchrotron data was collected at beamlines CMCF-ID and CMCF-BM of the Canadian Light Source (CLS) synchrotron, while Cu K-α data was collected on a MicroMax-007 HF generator (Rigaku Corp.). Detailed collection parameters for each of the three deposited DdrC structures are provided in Supplementary Table S5 .

Crystal structure solution

All data sets were integrated and scaled using autoPROC (Global Phasing Ltd) ( 29 ). For the crystal structure corresponding to PDB 7UDI, an initial electron density map was generated by experimental SAD phasing and density modification using Phenix AutoSol ( 30 ). A model of the asymmetric unit containing two DdrC chains was built into the density map using Buccaneer, then refined iteratively in Coot and Phenix Refine ( 30–32 ). The atomic coordinates and structure factors were deposited in the Protein Data Bank under the accession 7UDI (DOI: 10.2210/pdb7UDI/pdb). Residues and sidechains with missing electron density were modeled into the 7UDI crystal structure using Rosetta Remodel with the REF2015 score function ( 33 , 34 ). The L131M/L184M mutations were also reverted to WT to yield a complete model of a FL WT DdrC dimer. This model was deposited in ModelArchive under the accession ma-nmyn0 (DOI: 10.5452/ma-nmyn0).

For the crystal structures corresponding to PDB 8U0G and 8U1J, an initial electron density map was generated by molecular replacement (MR) of the search model PDB 7UDI using Phenix Phaser ( 30 ). In the case of 8U1J, the MR search model was limited to the first 98 residues of a single chain of DdrC. The crystal structures of both 8U0G and 8U1J were built and refined the same way as 7UDI, then deposited to the PDB (DOI: 10.2210/pdb8U0G/pdb, 10.2210/pdb8U1J/pdb). Relevant data processing and model refinement statistics are available in Table 3 .

Domain and symmetry analysis

Inter- and intra-molecular contacts within the DdrC dimer were identified from the filled 7UDI crystal structure by automated algorithms in PyMOL (Schrödinger, LLC). To identify possible domain boundaries by structural homology, the DdrC structure was queried for structural similarity against the entire PDB databank using the DALI protein structure comparison server ( 35 ). The DALI results were then analyzed using DALIview (DOI: 10.5281/zenodo.8435478) to reveal structurally similar domain families.

Axes of symmetry were identified within the DdrC dimer by calculating the midpoint positions in 3D space between every atom in chain A and its analogous atom in chain B. The list of 3D midpoints was grouped according to DdrC domains, then subjected to Principal Component Analysis (PCA), yielding a list of PCA eigenvectors for each DdrC domain. The longest eigenvector for each domain corresponds to a fitted C2 axis of symmetry when plotted in 3D space.

To identify the source of DdrC dimer asymmetry, the angular differences between chain A and chain B backbone torsion angles were calculated for all phi ( ⁠|$\varphi$|⁠ ) and psi ( ⁠|$\psi$|⁠ ) angles. The absolute angle differences at each residue position ( ⁠|$| {\Delta \varphi } | + | {\Delta \psi } |$|⁠ ) were mapped onto the structure in PyMOL according to a color gradient.

Computational docking

Electrostatic surface potentials were calculated for experimental and theoretical DdrC structures using the APBS software suite ( 36 ).

To generate an atomic model of DdrC in complex with un-nicked intact dsDNA, a DNA duplex of arbitrary sequence and length was docked onto the filled 7UDI crystal structure using the rigid protein/flexible DNA algorithm, Paradock ( 37 ). The top-scoring output model from Paradock was then refined against the Rosetta REF2015 score function through 1000 stochastic repetitions of the Rosetta relax protocol ( 34 , 38 ). The top-scoring model was deposited to ModelArchive under the accession ma-urph3 (DOI: 10.5452/ma-urph3) and used for downstream analysis.

A model of DdrC in complex with a 21 bp nicked DNA duplex was predicted using the RosettaFoldNA neural net model (v0.1) from the amino acid sequence of DdrC and the nucleotide sequence of 3 complimentary DNA oligonucleotides (CGTCATCACCGAAACGCGCGA, TCGCGCGTTTCGG and TGATGACG) ( 39 ). The top-scoring output model was then refined using the same method as for the un-nicked DNA model, except with an explicit C2 axis of symmetry. The top-scoring model was deposited to ModelArchive under the accession ma-50nj9 (DOI: 10.5452/ma-50nj9).

Finally, a model of DdrC in complex with a terminal dsDNA end was generated from the nicked dsDNA model by removing nucleotides that are downstream from the nick. The resulting model was refined and deposited to ModelArchive under the accession ma-otnza (DOI: 10.5452/ma-otnza).

UV-C survival assay

The native DNA sequence of D. radiodurans ddrC was synthesized in the form of either WT, NTD-mut or CTD-mut variants together with the Deinococcal constitutive promoter PDR_1261 ( Supplementary Figure S18 ) ( 40 ). The synthesized DNA fragments were then subcloned into pRad1 at XhoI / XbaI restriction sites to generate a series of ddrC complementation plasmids ( 41 ). Plasmid details are summarized in Supplementary Table S1 . D. radiodurans R1 strains harboring ΔuvsEΩhygro and ΔuvsEΩhygroΔddrCΩkan genomic deletions were obtained from Dr. Fabrice Confalonieri and transformed with plasmid as previously described ( 25 , 42 ). Transformants were selected and cultured in the presence of 50 μg/ml Hygromycin-B, 6 μg/ml Kanamycin or 3 μg/ml Chloramphenicol, as appropriate. Each transformant was cultured in liquid 2×TGY media at 32°C to an OD 600 of 1.0, then serially diluted, spot plated, and exposed to a UV-C light source (254 nm) at a fixed distance for varying lengths of time. UV exposure dose was calculated from radiometer dose rate measurements. The UV-treated TGY-Agar plates were incubated at 30°C for 60 h, then imaged and analyzed. The surviving fraction of D. radiodurans was measured in triplicate by comparing the CFU counts at each UV-C dose to unirradiated bacteria.

DdrC compacts circular dsDNA through interactions with single-strand breaks

When DdrC is incubated with supercoiled, relaxed, or linear forms of ΦX174 plasmid dsDNA, the DNA mobility is shifted into the well at high DdrC concentrations (Figure 1A – D ). This suggests the formation of a large intermolecular complex. It is unclear whether this species is of any biological relevance. At lower DdrC concentrations (<300 nM DdrC per nM DNA), DdrC forms smaller complexes with DNA, as the bound species migrates into the gel.

Gel motility shifting of dsDNA upon DdrC binding. 2 nM of ( A ) supercoiled, ( B ) linear, ( C ) randomly nicked and ( D ) single-nicked ΦX174 dsDNA plasmids incubated with DdrC at varying concentrations. ( E ) Addition of Proteinase K to a pre-formed DdrC-DNA complex with randomly nicked ΦX174.

Interestingly, the electrophoretic mobility of this smaller species is shifted differentially by DdrC depending on the starting plasmid topology. Both linear and supercoiled ΦX174 are shifted to a discrete species in the presence of DdrC (Figure 1A , B ), but, the shift in mobility of supercoiled DNA is progressive, whereas that of linear DNA is sudden ( Supplementary Figure S1 ). In other words, supercoiled plasmid appears to have multiple DdrC binding sites, whereas linear plasmid only has one.

The most surprising binding behaviour across the different ΦX174 isomers is the observation that relaxed ΦX174 results in an increase of plasmid mobility. This is unexpected, as DNA binding proteins typically impede the mobility of their DNA binding partners on a gel, rather than increase it. An increase in DNA mobility can only occur in three situations: (i) the DNA/protein complex is more negatively charged than the DNA on its own, (ii) the DNA sequence is physically shortened by nuclease digestion or (iii) the DNA undergoes topological changes which lowers its radius of gyration.

It is highly unlikely that the increased DNA mobility is the result of a more negative net charge upon complexation with DdrC, as DdrC has a theoretical p I of 9.7 and is expected to have a net charge of +5 under Buffer M conditions. To examine whether the change in mobility is due to nuclease activity, Proteinase K was added to the DNA following incubation with DdrC (Figure 1E ). The addition of Proteinase K to a pre-formed DdrC-DNA complex restores the mobility of the plasmid to its unbound state, demonstrating that the increase in mobility is not a result of nuclease degradation. It has been shown previously by TEM that DdrC induces DNA compaction of relaxed plasmid DNA ( 25 ). We propose that the fast-moving species formed upon the addition of DdrC is in fact compacted plasmid. Interestingly, compaction of ΦX174 plasmid by DdrC is observed to a much greater degree when the plasmid contains many randomly generated single-strand breaks compared to plasmid harboring a single enzymatically-produced nick (Figure 1C , D ). So, plasmid compaction by DdrC appears to be dependent on the presence of nicks.

DdrC induces DNA compaction through the bridging of two distal nick sites

Since plasmid compaction seems to be dependent on the presence of ss-breaks, it seems very likely that DdrC is recognizing and binding directly to DNA nicks. We tested this assumption by assaying the binding characteristics of DdrC to a short 22-mer DNA duplex with and without an internal ss-break (Figure 2A ). As expected, a discrete band shift was observed only when a nick was present. This result demonstrates that DdrC recognizes and binds to ss-breaks directly. Furthermore, it appears that DdrC is stabilizing the nicked DNA duplex as the DNA transforms from a smeared, diffuse band in the unbound state to a sharp, discrete band in the bound state. Stoichiometrically, the DNA band was nearly fully shifted at a ratio of 2 DdrC monomers per nick, suggesting that DdrC binds to the DNA as a dimer. But this does not explain the mechanism by which DdrC compacts plasmids. Binding of DdrC to the 22-mer duplex results in an upwards band shift, as opposed to a downwards shift, as observed with ΦX174 plasmid harboring multiple nicks. This is likely because the 22-mer DNA fragment is too short to become compacted. Also, it appears that the degree of compaction may be dependent on the number of nicks available on the DNA.

Characterization of the interactions between DdrC and single-strand breaks. ( A ) DdrC-induced motility shift of a 22 bp dsDNA fragment at 100 nM with an internal nick that is either present or absent. ( B ) DdrC-induced motility shift of pUC19 plasmid at 2 nM that has been pretreated with either Nt. BspQI or Nb.BssSI nicking endonucleases. ( C ) SNM1a exonuclease or BglI endonuclease digestion of nicked pUC19-DdrC complexes at varying DdrC concentrations. ( D ) DdrC-induced motility shift of nicked pUC19 that has been dephosphorylated with rSAP. ( E ) Motility shift of variably-nicked pUC19 plasmid following incubation with 75 nM of DdrC. Terminal 5′ phosphates at single-strand break sites are depicted with red circles. Relative positions of nicks on plasmid schematics are to scale. ( F ) Proposed interpretation of plasmid compaction assay.

Since multiple random nicks on ΦX174 plasmid yields a smear of compacted species, while a single nick yields almost no compaction, we hypothesized that a plasmid harboring a discrete number nicks would result in compaction to a discrete species. To test this hypothesis, DdrC was incubated with pUC19 that has been relaxed from its supercoiled state using Nt.BspQI or Nb.BssSI nicking endonucleases, which introduce exactly one or three nicks on pUC19, respectively (Figure 2B ). Like with the ΦX174 plasmid, no compaction was observed when there was only one nick present. But when three nicks were present, DdrC compacted the pUC19 plasmid to a single, discrete species, as expected. This result demonstrates that the mechanism of plasmid compaction by DdrC is dependent on the number of available nicks.

Given that DdrC clearly binds to a short, nicked duplex (Figure 2A ), it is likely that the 1-nick pUC19 plasmid is also being bound by DdrC, despite the lack of a visible band shift. We hypothesize that a single nick is sufficient for DNA binding, but insufficient for DNA compaction, so the plasmid remains in a circular, relaxed topology when bound by DdrC. To verify that DdrC binds to the ss-break on the 1-nick pUC19 plasmid, the plasmid was incubated with varying concentrations of DdrC, then treated with either an SNM1a, or BglI nucleases (Figure 2C ). SNM1a is a 5′→3′ exonuclease that initiates digestion from nick sites ( 27 , 43 ), while BglI is a is sequence-specific endonuclease that happens to digest pUC19 at two remote sites that are distant from the three engineered nicks. Under our assay conditions, DdrC protects DNA from SNM1a exo-digestion, but not BglI endo-digestion. In contrast, the DNA-binding protein PprA from D. radiodurans , which is known to form protein filaments, inhibits both endo- and exo-nuclease activity under the same conditions ( Supplementary Figure S15 ) ( 44 , 45 ). These findings demonstrate that DdrC binds to dsDNA directly at the site of the ss-break site and nowhere else on the plasmid. As such, the lack of a downwards band shift in the 1-nick pUC19 plasmid is not due to a lack of DNA binding, but because a single nick is insufficient for the DdrC compaction mechanism.

To further investigate the mechanism of nick recognition, we examined the requirement of a 5′ terminal phosphate for DdrC compaction, since the presence of a free 5′ phosphate chemically differentiates nicked from unnicked dsDNA, and dedicated phosphate recognition sites have been identified in a large subset of proteins in the PDB ( 46 ). First, terminal 5′ phosphates were removed from the 3-nick pUC19 substrate using varying amounts of Shrimp Alkaline Phosphatase (rSAP). SNM1a, a 5′ phosphate-dependent exonuclease, was used to probe for available 5′ phosphates on the rSAP-treated pUC19 samples. No SNM1a digestion was detected when treating pUC19 with 4 U rSAP/μg DNA, indicating that there are no available 5′ phosphates in the 4 U/μg population of nicked pUC19 ( Supplementary Figure S2 ). This sample of pUC19 was then incubated with DdrC (Figure 2D ). Treatment of 3-nick pUC19 with rSAP has no effect on subsequent DNA compaction by DdrC. So the mechanism of nick binding and plasmid compaction by DdrC must involve a mechanism that does not rely on interactions with a terminal 5' phosphate. Many DNA lesion sensing proteins evolved to exploit the altered mechanical properties of DNA at the site of lesions ( 47 ). We hypothesize that DdrC may rely on a similar mechanical sensing mechanism since a DNA duplex would have higher conformational freedom at the site of a ss-break.

The data presented so far strongly implies that there is a relationship between the number of available of nicks on a plasmid and the degree to which that plasmid becomes compacted by DdrC. We have observed that plasmid with a single nick does not undergo significant compaction by DdrC, whereas a plasmid with exactly 3 nicks is compacted to a single species, and a randomly nicked plasmid is compacted to an even greater degree with a large distribution in gel mobility.

To examine the relationship between DNA compaction and the number of available single-strand breaks, a series of variably nicked pUC19 plasmids were generated. The sequence of pUC19 allows for the addition of evenly spaced nicks using commercially available nicking endonucleases. This was possible because the pUC19 sequence contains 1 Nt.BspQI site, 3 Nb.BssSI sites and 4 Nb.BstNBI sites. Then, a variant of pUC19 was generated via mutagenesis to contain only two Nb.BssSI sites to prepare a plasmid with exactly 2 nick sites,.

Nt.BspQI, Nb.BssSI and Nb.BstNBI endonucleases were then used to prepare the series of topologically relaxed pUC19 plasmids containing 0, 1, 2, 3 and 4 single-strand breaks ( Supplementary Figure S3 ). This series of nicked pUC19 plasmids were then incubated with DdrC (Figure 2E ). As expected, it was observed that DdrC induces compaction of the nicked plasmids to discrete species and that the degree of compaction increases with the number of available nicks.

To measure the degree of compaction, a pUC19 ‘compaction marker’ was prepared and run on the gel alongside the DdrC-compacted species (Figure 2D ). The compaction marker was generated by nicking and subsequently re-ligating pUC19 plasmid, yielding a mixture of at least five supercoiled topoisomers of pUC19. This was possible as circular, nicked DNA can freely rotate around the strand opposite from the nick due to random thermal motion, leading to spontaneous over- or under-winding of the DNA duplex. Ligation of the nicks then traps the molecules in discrete supercoiled states and produces a set of identical plasmids that differ only in their topological linking number (Δ L k ) by positive or negative integer values ( 48 , 49 ). The distribution of the Δ L k values is Gaussian and can be altered by varying the temperature during ligation ( 48 , 49 ). This plasmid mixture effectively acts as a quantized DNA marker for pUC19 supercoiling with linking numbers (Δ L k ) between 0 and 4. The mobility of the DdrC-compacted species was then measured relative to the compaction marker (Figure 2D ). Interestingly, the mobility of the DdrC-compacted species also appears to be ‘quantized’ as they only seem to take on values corresponding to specific pUC19 topoisomers in the marker (Table 1 ). In short, a single nick leads to an apparent Δ L k of 0. Two and three nicks both result in an apparent Δ L k of 1, and four nicks results in a Δ L k value of 2.

Apparent linking numbers of DdrC-bound pUC19 plasmids—circular

a Mobility distances are measured relative to the Δ L k = 0 and Δ L k = 4 samples in the topo marker.

b Linking numbers are calculated by linear interpolation from Topo marker standards.

Each of the five species in the compaction marker is expected to have a set number of writhe points, which are figure-8 structures that form spontaneously to resolve the torsional strain of supercoiling ( 50 ). These differences in plasmid shape account for the differences in gel mobility. Since the mobility of the DdrC-compacted plasmids appear to match the mobility of specific pUC19 topoisomers, we hypothesize that the DNA structures formed upon DdrC binding are similar to the writhe point structures that arise in supercoiled plasmids. It is also apparent that DdrC-mediated compaction only occurs when there are two or more nicks available on the plasmid, after which point, the apparent linking number of the bound pUC19 increases by one with every two additional nicks. These observations offer insight into the mechanism of DNA compaction by DdrC (Figure 2F ). Simultaneous binding of two distal nick sites by a single protein would produce a topological constraint on DNA that looks like a single DNA writhe point by agarose gel electrophoresis. Since the apparent linking number of the bound pUC19 increases by one with every two additional nicks, we can conclude that each unit of DdrC recognizes and binds to two nicks on the plasmid. As such, these data strongly suggest that the mechanism of DdrC plasmid compaction occurs through bridging two distal nick sites into close spatial proximity.

Although we did not detect any binding to unnicked, relaxed pUC19, we did observe significant binding of DdrC to supercoiled pUC19 ( Supplementary Figure S4 ). The same behavior was observed with ΦX174 plasmid ( Supplementary Figure S1 ). Unlike binding to other dsDNA substrates, the degree of band shifting appears to be progressive in the case of supercoiled plasmid. In other words, a higher concentration of DdrC yields a more prominent shift, up to a saturation point. This correlation indicates that each supercoiled plasmid can be bound by multiple molecules of DdrC. Supercoiled plasmid extracted from E. coli is expected to contain multiple writhe points. It is very likely that DdrC is binding to the writhe points of supercoiled plasmids, as these DNA structures may be the same structures that are induced when DdrC bridges two nicks during plasmid compaction. It follows then that the topology of DdrC-compacted DNA resembles the topology of supercoiled DNA; however, it is unclear whether DdrC actively supercoils DNA or if it simply induces a writhe point-like structure without over- or under-winding the DNA duplex.

DdrC circularizes linear dsDNA and compacts it in the presence of ssDNA breaks

The binding of DdrC to linear ΦX174 plasmid results in an upwards band shift to a single, discrete position (Figure 1B ). This result indicates that the protein–DNA complex is assembled from a fixed stoichiometric ratio of DdrC to DNA. Given that DdrC binds directly to single-strand breaks, it is highly likely that DdrC binds linear DNA fragments at double-strand break sites, which would explain why the complex has a discrete stoichiometry of DdrC to plasmid.

To characterize how DdrC interacts with double-strand breaks, we assessed whether DdrC has a preference for overhang type at the terminal ends of linear DNA. In this assay, one ds-break was introduced into pUC19 plasmid harboring either 0, 2 or 4 nt overhangs (5′) using SmaI, NdeI and SalI endonucleases, respectively. The varying overhang DNA fragments were then incubated with varying concentrations of DdrC and the shift profiles were visualized on a gel (Figure 3A ). It is clear that DdrC has a significantly higher affinity for blunt ds-breaks when compared to overhangs: ∼2-fold higher when compared to a 2 nt overhang, and ∼7-fold when compared to a 4 nt overhang.

Characterization of the interactions between DdrC and double-strand breaks. ( A ) DdrC-induced motility shift of pUC19 plasmid at 2 nM that has been pre-treated with three different endonucleases: SmaI, NdeI and SalI. ( B ) Motility shift of blunt-end linear pUC19 compared to unbound, circular pUC19 ( C ) Motility shift of blunt-end linear pUC19 plasmids following incubation with 75 nM of DdrC. Linearized pUC19 plasmids were relaxed with nicking endonucleases to harbor a specific number of nicks. Nick sites are represented with red triangles and their relative positions on the linear plasmid schematics are to scale. ( D ) Proposed model of linear plasmid circularization and compaction by DdrC.

Despite differences in affinity, the shifted DNA migrates to the same discrete position regardless of overhang type. Interestingly, the gel migration position of bound, linear pUC19 appears to be the same as unbound, relaxed circular pUC19 (Figure 3B ). This suggests that the topology of the two species is the same. In other words, DdrC appears to be circularizing linear DNA. If this is the case, then we would expect linear pUC19 harboring single-strand breaks to become compacted in the same way as circular nicked pUC19.

To test this hypothesis, we generated blunt-end, linear pUC19 harboring 0, 1, 2, 3 and 4 nicks ( Supplementary Figure S3 ). This series of linear plasmids was then incubated with DdrC (Figure 3C ). As expected, compaction is observed with the nick-harboring DNA. As with the circular plasmids, the degree of compaction scales with the number of available nicks on the plasmid (Table 2 ). This result strongly suggests that DdrC circularizes linear DNA via bridging of ds-breaks, then circularized plasmid can become compacted via bridging of ss-breaks (Figure 3D ). The nick-bridging model of plasmid compaction by DdrC suggests that each functional unit of DdrC has two DNA binding sites. Each binding site can recognize and bind to either a ss-break or ds-break.

Apparent linking numbers of DdrC-bound pUC19 plasmids—linear

Previously, it has been reported that DdrC has a higher affinity for ssDNA than dsDNA at a fragment size of 67-mer ( 25 ). In both cases, the DNA fragments were shifted to a discrete position on the gel, indicating that the complex is composed of a fixed stoichiometric ratio of DdrC to DNA. A fixed ratio suggests that DdrC is binding to both DNA fragments at the termini. We hypothesize that the apparent preference for ssDNA may be a symptom of selective DNA circularization by DdrC. Since the persistence length of dsDNA is about 50 nm (150 bp), while that of ssDNA is about 0.75nm (<5 nt), then a DNA length of 67-mer may be sufficient for circularization of ssDNA, but not dsDNA ( 51 ). Consequently, a 67-mer fragment of ssDNA may be able to contact both binding sites on DdrC, while a dsDNA duplex of the same length would only contact one. The ability of one ligand to contact more binding sites should correspond with a higher apparent binding affinity in a gel shift assay. To test this hypothesis, the experiment by Bouthier de la Tour et al.  was repeated using shorter 48-mer ssDNA and dsDNA ligands ( Supplementary Figure S16 ). Under these conditions, we do not observe a preference for either dsDNA or ssDNA, suggesting that in both cases, the DNA is only contacting a single binding site on DdrC. We hypothesize that the 48-mer ssDNA is either too short, too rigid, or contains secondary structures that prevent it from contacting both binding sites on DdrC.

DdrC is a homodimer with two structural domains

To gain insight on the molecular mechanism of DdrC nick detection, we solved the structure of DdrC by X-ray crystallography. Crystals of selenomethionyl (SeMet)-derivatized DdrC were grown and diffracted at the X-ray wavelength corresponding to the absorption edge of selenium. Although the resulting diffraction data was of high quality and resolution (Table 3 ), the anomalous signal did not have sufficient phasing power to recover the phases of measured structure factors. We suspect that too few methionine residues are to blame for the weak anomalous signal, as D. radiodurans DdrC only contains one internal methionine per monomer, and so a SeMet-derivatized DdrC crystal could only contain one structured selenium atom for every 231 native residues.

X-ray data collection and processing statistics

a Data collection statistics for high-resolution shell indicated in parentheses.

b Atoms with non-zero occupancy.

To overcome this obstacle, we introduced additional SeMet residues into DdrC at structured positions where SeMet substitution seems structurally and functionally safe. These two positions, Leu-131 and Leu-184, are frequently substituted to methionine in other close DdrC homologs that have highly conserved local sequence, and so L131M and L184M substitutions should have minimal effect on local and global folding in D. radiodurans DdrC ( Supplementary Figure S5 ). Crystals of SeMet-derivatized L131M/L184M DdrC were then grown, diffracted, and successfully phased, allowing for the solution and refinement of the crystal structure. This structure was deposited in the PDB under the accession code 7UDI (Figure 4A , Table 3 ). The structure of 7UDI was then used to phase diffraction data from the WT DdrC crystal by molecular replacement (MR). This structure was deposited in the PDB under accession code 8U0G ( Supplementary Figure S6 , Table 3 ).

Structural characterization of DdrC domains. ( A ) Crystal structure of the full-length DdrC homodimer colored according to predicted domain boundaries. Residues with missing electron density were modeled using Rosetta remodel and are represented with a dashed backbone. All inter- and intra-molecular sidechain interactions within the dimer are represented on the 1D domain map. ( B ) Differential scanning fluorimetry profiles of 3 truncated DdrC variants. The T m value corresponding to each dF/dT peak is indicated with an arrow. ( C ) Crystal structure of a proteolytically-degraded sample of DdrC. The integrity of the protein in the source crystallization drop was verified by SDS-PAGE pre- and post- crystallization and was compared to the integrity of the protein in the FL DdrC crystallization condition. The expected positions of possible DdrC species are indicated with arrows. ( D ) SEC-MALS analysis of the oligomeric state of three truncated DdrC variants.

Interestingly, both crystal structures had different lattice symmetries and crystal contacts. Despite the difference in lattice contacts, one common interaction interface persisted between the two structures (Figure 4A ). Conservation of this protein-protein contact strongly suggests that this is a biologically relevant interaction interface. We then determined by SEC-MALS that DdrC exists as a dimer in solution (Figure 4D , Table 4 ). Therefore, the interface identified by crystallography is most likely the dimerization interface.

SEC-MALS measurements of the oligomeric state of different DdrC variants in solution

From the crystal structure of DdrC, it appears that the protein is composed of two distinct domains, since the inter-and intramolecular contacts holding the dimer together are localized to either one of two regions: the N-terminal domain (NTD) that spans residues M1 to E110 and the C-terminal domain (CTD) that spans residues P111 to G231 (Figure 4A ). The first α-helix in the CTD contains a short stretch of 17 residues (P111-A126) that has an alternate conformation between the two DdrC chains. As such, we identified this section as a flexible ‘linker’. We generated the NTD and the CTD as independent proteins at these proposed domain boundaries (NTD: 1–110, CTD: 111–231), but the CTD exhibited very poor solubility. This poor solubility is likely the result of exposed hydrophobic residues, L117 and L121, that would otherwise interface with the NTD in the full-length protein. To improve solubility of the truncated domains, we generated NTD and CTD constructs with an altered domain boundary that neutralizes these exposed hydrophobic residues (NTD: 1–98, CTD: 99–231). These constructs were successfully expressed, purified, and remained stable in solution.

The presence of two distinct domains is supported by differential scanning fluorimetry (DSF) analysis, as full-length (FL) DdrC exhibits two melt peaks: one with a melting temperature ( T m ) of 40°C and one with a T m of 73°C (Figure 4B ). Each of the two proposed DdrC domains, NTD and CTD, were then analyzed under DSF separately as independent protein constructs. The thermal melt curves of the NTD and CTD constructs contained only one melt peak, each with a T m of 73°C and 37°C, respectively, matching the two T m values observed with FL DdrC. Both prominent melting events in the FL DdrC melt profile can be explained individually by the NTD and CTD melt profiles, demonstrating that the NTD and CTD are structurally distinct domains that fold independently of one another.

To investigate the possible role of each domain by structural homology, we queried the crystal structure of FL DdrC for structural similarity against the PDB databank. As expected, the NTD and CTD regions independently align to different structures, further supporting the hypothesis that the NTD and CTD of DdrC are distinct domains ( Supplementary Figure S7 ). The proteins that aligned most closely to the NTD were primarily members of the Dachshund homology domain (DHD) spanning residues ∼1–73 of DdrC. The CTD did not align to any specific domain family, but rather to an array of 3- and 4-helix bundles found broadly across the PDB. The degree of alignment of any characterized protein to either the NTD or CTD is too poor to extrapolate any meaningful functional significance.

NTD and CTD domains dimerize independently

To facilitate crystallization of FL DdrC, it was necessary to first optimize the buffer, pH and salt conditions of the protein storage solution for optimal protein stability ( Supplementary Figure S8 ). When storage conditions were sub-optimal, crystallization trials of WT FL DdrC did not yield any DdrC crystals, except on one non-reproducible occasion where a third crystal form was identified with a different unit cell and symmetry from the two previous crystal structures (PDB: 8U1J). Structure determination by MR revealed a DdrC dimer that was only comprised of residues 1–97 from the NTD (Figure 4C ). The remaining CTD residues (98–231) lacked any significant electron density. The relatively low refinement R -factors indicate that the NTD dimer model agrees with the experimental data and that the remaining 58% of the protein is either highly flexible under these conditions, or completely absent from the crystal lattice (Table 3 ). Given the expected structure of the CTD, residues 99–231 would not have fit into the observed crystal lattice ( Supplementary Figure S6 ), so it appeared as though DdrC was somehow crystallized without the CTD domain. The source crystallization drop was analyzed by SDS-PAGE, and it was confirmed that DdrC was indeed proteolytically digested in the drop, resulting in an apparent molecular weight that is consistent with residues 1–98 (Figure 4C ). This digestion was likely the result of an unknown contaminating protease. The high resistance of the NTD against proteolytic degradation is consistent with the previous observation that the NTD is more resistant to thermal denaturation than the CTD (Figure 4B ), implying that the NTD has high structural stability compared to the CTD.

The NTD crystal structure demonstrates that residues 1–98 of DdrC dimerize independently from the rest of the protein. In fact, the NTD dimer in the truncated crystal structure was nearly identical to the NTD dimer in the FL crystal structure (RMSD: 1.36Å). To validate that the NTD dimerizes in solution and not just in a stabilized crystal lattice, DdrC was expressed explicitly as a 1–98 truncation and purified. Upon measuring the oligomeric state by SEC-MALS, we found that the NTD does in fact dimerize in solution (Figure 4D , Table 4 ).

Despite the low stability of the CTD domain, we cannot rule out the possibility that the CTD can also dimerize independently of the rest of the protein. Attempts to express the CTD on its own (residues 99–231) yielded insoluble protein aggregates. However, we were able to express the CTD domain with a monomeric OCR (mOCR) fusion tag. The CTD remained stable and soluble following cleavage and removal of the fusion tag under optimized buffer conditions. SEC-MALS analysis revealed that, like the NTD, the CTD also dimerizes independently in solution (Figure 4D , Table 4 ).

Attempts to crystalize the CTD explicitly yielded no crystals, but it would be safe to assume that the dimerization interface of the CTD on its own would be the same interface as seen in the FL DdrC structure. Together, the NTD crystal structure with the SEC-MALS and DSF data demonstrate that the NTD and CTD domains fold and dimerize independently from each other.

The DdrC homodimer is asymmetric

When analyzed independently, the NTD and CTD each homodimerize symmetrically via a C2 axis of rotation. Curiously, the full DdrC homodimer comprising both NTD and CTD domains is itself asymmetric, with no global axes of symmetry between the two chains (Figure 5A ). In the context of the FL DdrC dimer, the C2 axes of the NTD and CTD are offset from each other by 46°. The same asymmetric structure is seen in both crystal forms despite different protein contacts and different chemical environments. So, this asymmetry is likely an endogenous structural feature, and not just a crystallographic artifact. Studying the nature of this asymmetry may reveal a molecular mechanism for DdrC function.

Analysis of structural asymmetry in the DdrC homodimer. ( A ) DdrC homodimer structure with highlighted midpoint positions between pairs of opposing homodimer atoms. Symmetry axes were fit by Principal Component Analysis (PCA) of midpoint positions for each domain. ( B ) Torsion angle differences (ΔΦ + ΔΨ) between both chains of the DdrC homodimer. The residues that most contribute to global asymmetry are indicated (★). ( C ) Loaded and relaxed conformations of the α6 helix from chains A and B, respectively. ( D ) Holding clasp residues in the disengaged and ( E ) engaged states. ( F ) Static forces in the DdrC homodimer counteract each other in a loaded mousetrap mechanism.

Comparing the internal coordinates between both DdrC chains, it is clear that the asymmetry can be attributed to only five residues within the interdomain region: residues 120–125 (Figure 5B ). The torsion angle differences between both DdrC chains at residues 120–125 account for all the global asymmetry in the DdrC dimer. In one DdrC chain, residues 120–125 lie within an intact helix, α6, which spans residues 111–136. In the other DdrC chain, α6 is deformed at residues 120–125, breaking the helix into two separate segments (Figure 5C ). Since the α6 residues clearly have a propensity to form a helix, we can assume that the broken α6 helix is under tension, like a bent spring.

The tension in the bent spring appears to be counteracted by a strong network of salt-bridges and H-bonds between the NTD and the CTD on only one face of the dimer (Figure 5E ). This ‘holding clasp’ mechanism involves the NTD from chain A (Gln-103, Glu-106) and the CTD from chain B (Arg-120, Asp-174). Meanwhile, the analogous clasp on the opposite face of the dimer is disengaged as the residues are not within range to form this interaction network (Figure 5D ). Interestingly, in the 7UDI crystal structure, the electron density is missing for residues 157–174 on the disengaged face of the dimer, suggesting that the CTD residues surrounding the holding clasp may be flexible when Asp-174 is not engaged.

We hypothesize that static forces within the DdrC homodimer counteract each other in a loaded mousetrap mechanism (Figure 5F ). A deformed α6 helix forms a loaded spring while an H-bond network forms a clasp that holds the spring under tension. It is possible that the mousetrap mechanism is a method for storing potential energy that can be used by DdrC to carry out its biological functions. If this is the case, then the mechanism must be triggered in response to a specific biochemical signal. This signal may be the terminal ends of DNA strands as we have shown that DdrC binds to ss- and ds-breaks with high affinity.

Dimer asymmetry may form the basis of the DdrC nick detection mechanism

To investigate the structural basis of DNA nick detection by DdrC, it is necessary to determine the structure of DdrC in complex with DNA. Ongoing efforts to co-crystalize DdrC with different DNA ligands have yet to produce diffracting crystals; however, the apo-structure of DdrC hints at the location of two possible DNA binding sites. The electrostatic surface potential of the DdrC dimer reveals two large patches of partial positive charge on the surface (Figure 6A ). Even though both potential binding sites involve the same residues from opposing chains, they each have a different shape due to the asymmetry of the DdrC dimer. One possible binding site appears to be in an ‘open’ conformation, while the other is in a ‘closed’ conformation.

Prediction of DdrC-DNA complex formation. ( A ) Surface representation of the DdrC homodimer colored by domains (center) and by electrostatic surface potential (left and right). Two large surface patches of positive electrostatic potential are highlighted (°,•). The positively-charged residues corresponding to each patch are indicated on a DdrC domain map (bottom). ( B ) Computational model of DdrC bound to a DNA duplex with no internal lesions. Axes of symmetry are shown corresponding to the NTD (yellow) and the CTD (green). ( C ) Electrostatic surface of contacting residues in the CTD and ( D ) the NTD. ( E ) Conformation of the α6 helices in the DdrC-DNA complex. ( F ) Computational model of DdrC bound to two DNA duplexes with one single-strand break each. ( G ) Contacting residues in the CTD and ( H ) the NTD. ( I ) Conformation of the α6 helices in the dual-nick complex.

We used a rigid protein, flexible DNA docking algorithm to dock a single dsDNA duplex onto a DdrC dimer ( 37 ). The entire complex was then minimized in Rosetta to sample optimal protein–DNA contacts. As expected, the dsDNA duplex docked to one of the positive patches on DdrC. Of the two possible sites, the DNA docked to the ‘open’ binding site (Figure 6B ). In this binding mode, most of the protein–DNA interactions are mediated by the CTD (Figure 6C ). Residues within the flexible CTD clasp make non-sequence-specific contacts with the minor groove to the DNA duplex. The DdrC clasp is slightly deforming the duplex as it presses the DNA into the NTD, where some contacts between the NTD and the DNA backbone are made (Figure 6D ). In this conformation, the α6 helices of DdrC are still in the ‘loaded’ state, so any tension that may have been stored in the ‘loaded spring’ has not been released (Figure 6E ). Since all of the DdrC-DNA contacts in this model involve only internal DNA nucleotides, as opposed to ss- or ds-break sites, we hypothesize that this binding mode represents a state of lesion scanning. In this state, DdrC may be scanning for ss- or ds-breaks by deforming the DNA and interrogating the DNA duplex for a specific mechanical response. To fully understand the mechanism of nick detection, a structure of DdrC bound to nicked DNA is also required.

Accurate prediction of a nicked dsDNA complex is challenging to accomplish using traditional docking methods because the addition of a single nick greatly increases the structural degrees of freedom of the DNA duplex. The docking algorithm would need to cover a very large conformational space for both the DdrC dimer and the nicked duplex in order to find the correct docking pose. Recent advances in structure prediction now allow for de novo prediction of protein-nucleic acid complexes from sequence using a trained neural-net model ( 52 ). One such algorithm, RF2NA, was used to predict the structure of a DdrC dimer in complex with a nicked DNA duplex, which was then minimized using Rosetta Relax (Figure 6F ). Unlike the unbroken DNA duplex, the nicked DNA was docked to the ‘closed’ pocket of the DdrC dimer. An unbroken DNA duplex would be unable to fit in the closed pocket, but the introduction of a single nick appears to increase DNA flexibility in such a way that binding to the closed pocket becomes possible. When a nick is present, the DNA duplex lends itself to significant deformation by residues within the CTD clasp. This deformation is primarily mediated by Lys-170 on DdrC as it protrudes into the DNA duplex and disrupts base-pair contacts, while forming a π-cation interaction with the face of a DNA base (Figure 6G ). The duplex deformation by the CTD also allows for nick-specific contacts to occur within the NTD. Most notably, Arg-14 is predicted to form a π-cation interaction with the terminal DNA base on the 5′ end of the nick, while Arg-81 forms a positively charged binding pocket for DNA backbone atoms on the 3′ end of the nick, including the terminal 3′OH itself (Figure 6H ). It is of note that the terminal Phosphate group on the 5′ end is not predicted to form any polar contacts with DdrC, and so it does not appear to be important for nick detection. This feature of the model matches experimental observations, as nick-mediated DNA compaction by DdrC is unimpaired when all 5′ Phosphates are removed (Figure 2D ).

Another interesting feature of the DdrC-nicked DNA structure is the change in global symmetry. RF2NA predicts a symmetric binding conformation of DdrC, where both the binding sites are in a ‘closed’ conformation, allowing for binding to two identical nicked duplexes. In this conformation, both α6 helices in the DdrC dimer are predicted to be in the relaxed state, suggesting that the tension in α6 has been released (Figure 6I ). In order for both DdrC binding sites to be in the closed states, it is necessary for the CTD dimer interface to be disrupted. This is the prediction made by the RF2NA algorithm. Given the low number of intermolecular contacts holding the CTD dimer together, and given the low thermal stability of the CTD alone (Figure 4B ), it is clear that the CTD dimer contacts are very weak. It is therefore plausible that the CTD interface becomes broken during the nick detection process, leading to two symmetric DNA binding sites.

Together, the unbroken DNA and nicked DNA binding models hint at a possible nick detection mechanism (Figure 7A ). First, DdrC binds to unbroken DNA along the open face of the dimer, ‘scanning’ for a nick. DdrC scans for nicks by attempting to deform the duplex using energy stored in the loaded α6 helix. If a ss-break is present, the DNA will lend itself to deformation and the ‘open face’ of DdrC will adopt a closed conformation. This conformational change causes the opening of a second DNA binding site on the opposite face of the dimer that was previously closed. The newly opened binding site is now free to scan for a second nick. Once a second nick is detected, the binding site closes, trapping two DNA nicks in a conformation that is symmetric about a C2 axis of symmetry. In this conformation, the DNA duplexes are placed in a perpendicular orientation to each other, which topologically mimics a supercoiling writhe point. This duplex crossover structure would mimic a positive supercoil if both nicks are on the same DNA strand, and would mimic a negative supercoil if the nicks are on opposite strands ( Supplementary Figure S9 ). By introducing a topological writhe point for every pair of ss-breaks, DdrC progressively compacts circular DNA to a degree that is proportional with the amount of DNA damage. In other words, more ss-breaks lead to more compaction (Figure 7B ).

Proposed mechanism of DNA lesion detection and DNA topology modulation by DdrC. ( A ) Mechanism of dual nick detection. ( B ) Mechanism of ss-break-mediated DNA compaction. ( C ) Proposed binding mode of DdrC to supercoiled DNA. ( D ) Mechanism of ds-break-mediated DNA circularization. High-affinity binding events requiring a conformational change in DdrC are labeled (★).

In addition to compacting nicked DNA via supercoil-like structures, we have observed that DdrC binds directly to DNA that is already in a supercoiled state prior to binding. The band shift that occurs when DdrC interacts with supercoiled DNA is progressive, meaning that the band becomes more shifted with increasing concentrations of DdrC up to a saturation point ( Supplementary Figure S1 ). This behavior implies that there are many possible DdrC binding sites on the supercoiled plasmid that become progressively saturated. Since the affinity of the supercoiled binding event is similar to that of nicked DNA, the binding mechanisms are probably also similar. In nicked DNA, DdrC recognizes lesions through duplex deformations. We hypothesize that DdrC recognizes regions of supercoiled DNA where similar duplex deformations arise spontaneously ( Supplementary Figure S10 ). It is well understood that supercoiled DNA adopts local DNA deformations such as wrinkles, bubbles, kinks and slips to alleviate the stresses of over- or under-winding ( 50 , 52–55 ). In many of these deformations, base pair and base-stacking contacts in the DNA are disrupted, exposing unpaired bases to solvent. Since DdrC recognizes DNA nicks through DNA deformations and π interactions with exposed bases, it is possible that DdrC recognizes some specific local deformation in supercoiled DNA via the same mechanism (Figure 7C ).

Finally, we have demonstrated that DdrC circularizes DNA via direct binding to ds-breaks. A plausible structure of the ds-break complex can be generated from the nicked complex by truncating the DNA to a blunt-end at the site of the nick and minimizing the resulting model ( Supplementary Figure S11A, B ). If we follow the proposed steps of nick detection with ds-breaks instead of ss-breaks, we inevitably arrive at a mechanism for DNA circularization by DdrC (Figure 7D ). Like with the nicked DNA substrate, the CTD forms sequence-independent contacts with the duplex and pushes the ds-break into the NTD of DdrC. The NTD then makes end-specific contacts with the 5′ and 3′ terminal ends of the DNA. According to this model, a 5′ overhang would disrupt the ability of the NTD to properly engage the 3′ end of the duplex ( Supplementary Figure S11C ). So, we would expect that a 5′ overhang should reduce the affinity of DdrC to ds-breaks. This is precisely what we have observed experimentally (Figure 3A ).

Functional behavior of DdrC mutants match predictions of the computational models

In our gel-based DdrC-DNA binding assays, we can resolve two distinct binding events: one that is dependent on, and one that is independent from the presence of DNA lesions; referred to as the high-affinity (HA) and low affinity (LA) binding events, respectively ( Supplementary Figure S14 ). The HA binding event occurs at relatively low DdrC concentrations (∼10–100 nM) and requires the presence of two or more dsDNA lesions in the form of single-strand or double-strand breaks. The HA mode of binding results in a complex with a fixed stoichiometric ratio of DdrC to DNA as evidenced by a band shift to a discrete position on the gel. This DdrC-DNA species likely corresponds to the DdrC-DNA complex in Figure 6F , as this mode of binding localizes DdrC to a specific site on the DNA. On the other hand, the LA binding event, which requires higher concentrations of DdrC (>1 μM), is indicative of non-specific interactions and occurs with any form of dsDNA, irrespective of the presence of lesions or DNA topology. This binding mode leads to a substantial upward gel shift of the DNA, often preceded by a ‘smearing’ of the band. The smearing suggests that the LA mode of binding involves a variable stoichiometric ratio of DdrC to DNA, potentially involving multiple DdrC molecules per plasmid. We hypothesize that the ‘scanning’ DdrC-DNA complex shown in Figure 6B corresponds to the LA binding event on the gel, as it allows DdrC to bind at any position on the plasmid, not just at the site of damage.

By monitoring the formation of the HA and the LA species, it is possible to independently assay the lesion-specific and non-specific binding activities of DdrC. If our computational models are correct, we should be able to disrupt these two binding activities selectively through targeted mutagenesis. To disrupt non-lesion-specific interactions (corresponding to the LA species), we targeted highly conserved residues on DdrC that are predicted to directly contact DNA in both our intact and nicked DNA models. Four residues (Arg-128, Arg-142, Arg-164 and Lys-170) were identified as potential candidates for disruption, as they are predicted to be involved in ionic interactions with the DNA backbone in both scanning and nick-binding states (Figure 8A ). These interactions were disrupted by substituting all four residues with alanine (CTD-mut) or by deleting the entire C-terminal domain (ΔCTD) (Figure 8B ).

Targeted disruption of DdrC-DNA interactions. ( A ) Predicted protein–DNA interface of the HA and LA complexes at the NTD and CTD domains. Residues that were targeted for mutagenesis are highlighted and labeled. ( B ) Summary of DdrC variants harboring disruptive amino acid substitutions and deletions. ( C ) DNA binding activity of each DdrC variant measured against pUC19 plasmid in 3 different topological states: nicked, linear and supercoiled. For each DdrC/plasmid combination, 2 nM of plasmid was incubated with varying concentrations of DdrC. The relative fractions of DNA were measured as bound in either the HA, LA or unbound states. The total percentage of bound DNA is plotted here as the sum of HA and LA fractions. ( D ) Survival of different D.radiodurans R1 strains in response to varying UV-C doses. The surviving fraction was measured in triplicate as CFU counts relative to unirradiated bacteria. All D.radiodurans strains harbor a ΔuvsE genetic background as well as a Deinococcus expression plasmid with the corresponding ddrC ORF under constitutive expression from the PDR_1261 promoter.

To disrupt lesion-specific interactions (corresponding to the HA species), we targeted residues predicted to selectively interact with nicked DNA, while not interacting with un-nicked DNA. Two such residues, Arg-14 and Arg-81, were chosen. Arg-14 is predicted to interact with the face of the terminal base on the 5′ end of the nick through a π-cation interaction, while Arg-81 is part of a positively charged binding pocket for DNA backbone atoms on the 3′ end of the nick, including the terminal 3′OH itself (Figure 8A ). To disrupt these interactions, we either substituted the residues with alanine (NTD-mut) or deleted the entire N-terminal domain (ΔNTD) (Figure 8B ).

The DNA binding characteristics of the DdrC variants were assayed against both linear, nicked, and supercoiled pUC19 (Figure 8C ). Disrupting the non-specific interactions (CTD-mut and ΔCTD) led to a disruption of all DNA binding activity, both LA and HA. The binding appears to be disrupted equally across all three topological forms of pUC19 plasmid. This finding is consistent with our computational models that predict that the CTD domain harbors the ‘core’ DNA binding residues of DdrC. These residues are required for binding to any DNA ligand.

Disrupting the lesion-specific interactions by removal of the NTD domain (ΔNTD) resulted in the complete loss of the HA binding event, indicating that the NTD domain is responsible for lesion recognition. Interestingly, there was still detectable LA binding activity with the ΔNTD protein. This demonstrates that the CTD alone is sufficient for DNA binding but not for lesion detection.

Disruption of the two predicted nick-recognition residues in NTD domain (NTD-mut) resulted in the complete loss of the HA binding event in the case of nicked pUC19. Interestingly, the mutations had a milder effect on HA binding in the case of linear and supercoiled pUC19. This finding suggests that residues R14 and/or R81 specifically bind to ss-breaks over ds-breaks. This is supported by the computational model of DdrC bound to ds-breaks, where only Arg-14 participates in recognition of the ds-break, but not Arg-81 ( Supplementary Figure S11B ).

Although the lesion recognition residues are located in the NTD, the NTD alone cannot effectively stabilize the DdrC-DNA complex, as evidenced by the complete lack of HA or LA binding in the ΔCTD variant. The mechanism of lesion detection by DdrC likely requires proper positioning of the DNA duplex by the CTD for the lesion to make proper contact with the NTD.

To verify whether DNA binding and lesion recognition are important features of DdrC function in vitro , we measured the effect of disruptive ddrC mutations on UV-C resistance in live Deinococcus bacteria. In D. radiodurans R1 , a deletion of the ddrC gene only exhibits a modest 10-fold reduction in UV-C resistance ( 25 ). However, when combined with a deletion of the uvsE gene, a ddrC deletion is 50–100-fold more sensitive to UV-C radiation compared to a knockout of uvsE alone ( 25 ). To maximize the signal-to-noise ratio of measurements quantifying the phenotype of ddrC point mutations, all functional assays were conducted in D. radiodurans with a ΔuvsE genetic background. The functional status of different ddrC viariants were measured by expressing ddrC from a plasmid in ΔuvsEΔddrC D. radiodurans then assaying for its ability to restore UV-C resistance relative to a ΔuvsE baseline phenotype.

As expected, D. radiodurans ΔuvsE harboring an empty expression vector becomes more sensitive to UV-C when a ddrC deletion is introduced (Figure 8D , Table 5 , Supplementary Figure S17 ). Under our experimental conditions, we measure a 94% loss in UV-resistance at doses of 200 J/m 2 or higher. This loss in UV resistance can then be restored by complimentary expression of WT ddrC . In fact, the ddrC complement appears to be 210% more UV resistant than the ΔuvsE baseline at 200 J/m 2 . When the same complementation experiment is performed using mutants of ddrC , neither the NTD-mut or the CTD-mut variants of ddrC can restore UV resistance to a ddrC knockout strain, indicating that these mutants disrupt ddrC function. When compared to WT ddrC , the NTD- and CTD-mut variants exhibit a 99.8% and 99.7% loss of UV resistance respectively at a UV dose of 200 J/m 2 . In vitro, we observe that the NTD-mut lacks the ability to bind ss-breaks while the CTD-mut is deficient in DNA binding overall. From these observations, we can conclude that both DNA binding and lesion recognition are essential features of ddrC function.

Surviving fraction of different D.radiodurans R1 strains in response to varying UV-C doses

Interestingly, both the NTD-mut and CTD-mut strains exhibit significantly lower UV resistance compared to the ddrC knockout strain, demonstrating that the presence of DdrC protein with a DNA-binding deficiency is more detrimental to UV resistance than a deletion of the ddrC gene alone (Figure 8D , Table 5 , Supplementary Figure S17 ). When compared to an empty vector, the plasmids harboring the NTD and CTD-mutants confer in an 89% and 83% loss in UV resistance respectively at a UV dose of 200 J/m 2 . This dominant-negative phenotype suggests that DdrC may have additional functions beyond DNA binding and lesion recognition. One possible explanation for the dominant-negative phenotype is that DdrC may play a role in recruiting other factors to DNA via protein–protein interactions. Consequently, a semi-functional DdrC mutant deficient in DNA binding but proficient in protein binding might interfere with the function of other DNA repair proteins by sequestering them away from DNA.

In this study, we demonstrate that DdrC binds to duplex DNA at sites of ss- and ds-breaks. The observed binding characteristics strongly suggest that each functional unit of DdrC contains two DNA binding sites.

This finding is corroborated by our crystal structure of DdrC, as there are two large patches of positive electrostatic surface potential on the DdrC dimer, which hint at the location of two DNA binding pockets. Interestingly, the two potential binding sites are structurally different, despite involving the same residues from opposing DdrC chains. This asymmetry appears to be an evolved feature of the DdrC dimer, as it has been observed by us and others under different crystal lattices ( 26 ).

Our computational modeling experiments suggest that in this asymmetric state, one binding site is in an open conformation while the other is in a closed conformation. We propose that DdrC transiently binds to DNA duplex at arbitrary positions via the open binding site and scans the duplex for lesions. These interactions primarily involve DdrC residues from the CTD domain.

The presence of a ss- or ds-break allows the DNA to form favorable interactions with DdrC residues in the NTD, triggering a conformational change in DdrC. This change in conformation opens the second binding site on DdrC, through which the DdrC dimer can scan for and trap a second DNA break. This mechanism is supported by functional assays with DdrC variants, which harbor disruptive amino acid substitutions and deletions. The findings indicate that the CTD involves the core DNA binding residues while the NTD contains residues that interact specifically with DNA lesions. We showed that mutation of these residues disrupts UV-C resistance in vivo , thus demonstrating that both DNA binding and lesion recognition are necessary features of DdrC function.

It is possible that the conformation change required for nick detection is driven by stored tension forces in the DdrC dimer. In the asymmetric scanning state, the α6 helix connecting the NTD to the CTD is significantly deformed in one DdrC monomer, but not in the other. The straightening of this helix would result in the re-symmetrisation of the DdrC dimer. We also observed a network of ionic interactions between the NTD of one DdrC chain and the CTD of the other. This ‘clasping’ mechanism appears to be holding the DdrC dimer in an asymmetric state. The presence of such a robust salt-bridge network may be taken as evidence that the clasp mechanism evolved to counteract a strong force in the opposite direction. As such, we propose that there is potential energy stored in the deformation of the α6 helix. The presence of a ss-break may trigger the release this energy, causing a conformation change in DdrC and the trapping of a DNA nick.

This is similar to the mechanism of nick detection in human cells, where single-strand breaks are rapidly bound by the signalling factor PARP-1 ( 56 ). When bound internally on an un-nicked DNA ligand, PARP-1 exists as a loosely associated string of protein domains with high potential energy. The protein interrogates the DNA for ss-breaks through dimerization interactions between the F1and F2 domains. Only in the presence of a ss-break can the F2 domain twist the DNA in such a way to enable a stabilizing π-stacking interaction between a Phe residue on PARP-1 and the face of a nucleotide base that is exposed at the site of the nick (PDB 2N8A ( 57 )). The proper dimerization of F1 and F2 initiates a ‘structure collapse’ where the other PARP-1 domains associate with F1, F2 and the DNA surface to collapse into a low-energy state. The structure collapse results in a very high affinity interaction with the ss-break. The fully formed PARP-1 assembly then recruits DNA repair factors to the site of damage and triggers the DNA-damage response cascade.

The proposed mechanism for nick detection by DdrC is also similar to the mechanism of inter-base adduct recognition by the Rad4/XPC complex ( 58 , 59 ). Like DdrC, Rad4/XPC binds DNA in a scanning conformation and interrogates the DNA duplex for lesions by attempting to adopt a lower-energy protein–DNA conformation. In the case of Rad4/XPC, the complex scans by flipping out DNA bases. Although base flipping is possible for both damaged and undamaged DNA, the kinetic barrier of this operation is much lower for DNA at the site of an inter-base adduct like a thymine dimer.

Unlike PARP-1 and Rad4/XPC, DdrC senses and traps two DNA lesions for each structural unit of DdrC. The consequence of trapping pairs of DNA breaks effectively results in the circularization of linear DNA and the compaction of nicked DNA. Furthermore, the degree of DNA compaction increases with the degree of DNA damage. We have shown this to be the case using a series of precisely nicked and linearized plasmids. It makes sense why this observed behavior of DdrC would be useful to Deinococcus bacteria under DNA damaging conditions. Two ss-breaks on opposite strands could become ds-breaks if they are close enough in proximity. The immobilization of ss-breaks and compaction of nicked DNA by DdrC could prevent ss-breaks from becoming ds-breaks as ss-breaks accumulate across the genome. In the event of a ds-break, DdrC is able to bridge the DNA ends to prevent end diffusion. In addition, the trapping of DNA lesions allows Deinococcus to control the supercoiling state of its genome, even in the presence of ss- and ds-breaks.

The plasmid compaction behavior of DdrC has been observed previously, although the dependence of this process on ss-breaks has not yet been reported. Using TEM and AFM techniques, DdrC has been shown to directly promote plasmid compaction and circularization in vitro ( 25 , 26 ). In vivo , DdrC has been observed to co-localize with the compact nucleoid DNA structures in D. radiodurans following rapid expression in response to γ-radiation ( 25 ). These observations led to the proposal that DdrC is a novel nucleoid-associated protein (NAP) that maintains a compact nucleoid structure following extreme DNA damage ( 25 , 26 ). Our results support this claim. We propose that DdrC behaves as a lesion-specific NAP that neutralizes ss-breaks and compacts the nucleoid to a degree that is proportional with the amount of DNA damage present. This would aid other NAPs in maintaining a compact nucleoid even in the presence of DNA damage. Furthermore, we observed a dominant-negative behaviour of DdrC mutations that are deficient in DNA binding and nick-recognition, suggesting that DdrC may have other functions beyond DNA binding. It is possible that through protein-protein interactions, DdrC may be interacting with other NAPs or may be recruiting other repair factors to the sites of DNA damage.

Refined crystal structures and structure factors were deposited to the Protein Data Bank under the accessions 7UDI (DOI: 10.2210/pdb7UDI/pdb), 8U0G (DOI: 10.2210/pdb8U0G/pdb) and 8U1J (DOI: 10.2210/pdb8U1J/pdb). Raw diffraction images for the crystal structures 7UDI, 8U0G and 8U1J were deposited to Zenodo under the accession numbers 10022358, 8302395 and 8309780 respectively (DOI: 10.5281/zenodo.10022358, 10.5281/zenodo.8302395, 10.5281/zenodo.8309780). Computational structure models were deposited to ModelArchive under the accession numbers ma-nmyn0 (DOI: 10.5452/ma-nmyn0), ma-urph3 (DOI: 10.5452/ma-urph3), ma-50nj9 (DOI: 10.5452/ma-50nj9) and ma-otnza (DOI: 10.5452/ma-otnza).

Supplementary Data are available at NAR Online.

Part of the research described in this paper was performed using beamlines CMCF-ID and CMCF-BM at the Canadian Light Source, a national research facility of the University of Saskatchewan, which is supported by the Canada Foundation for Innovation (CFI), the Natural Sciences and Engineering Research Council (NSERC), the National Research Council (NRC), the Canadian Institutes of Health Research (CIHR), the Government of Saskatchewan, and the University of Saskatchewan.

Natural Sciences and Engineering Research Council of Canada [2008R00075]. Funding for open access charge: Natural Sciences and Engineering Research Council of Canada [2008R00075].

Conflict of interest statement . None declared.

Slade D. , Radman M. Oxidative stress resistance in Deinococcus radiodurans . Microbiol. Mol. Biol. Rev. 2011 ; 75 : 133 – 191 .

Google Scholar

Cox M.M. , Battista J.R. Deinococcus radiodurans - the consummate survivor . Nat. Rev. Microbiol. 2005 ; 3 : 882 – 892 .

Gaidamakova E.K. , Sharma A. , Matrosova V.Y. , Grichenko O. , Volpe R.P. , Tkavc R. , Conze I.H. , Klimenkova P. , Balygina I. , Horne W.H. et al. . Small-molecule Mn antioxidants in Caenorhabditis elegans and deinococcus radiodurans supplant MnSOD enzymes during aging and irradiation . mBio . 2022 ; 13 : e0339421 .

Daly M.J. , Gaidamakova E.K. , Matrosova V.Y. , Kiang J.G. , Fukumoto R. , Lee D.-Y. , Wehr N.B. , Viteri G.A. , Berlett B.S. , Levine R.L. Small-molecule antioxidant proteome-shields in Deinococcus radiodurans . PLoS One . 2010 ; 5 : e12570 .

Sharma A. , Gaidamakova E.K. , Grichenko O. , Matrosova V.Y. , Hoeke V. , Klimenkova P. , Conze I.H. , Volpe R.P. , Tkavc R. , Gostinčar C. et al. . Across the tree of life, radiation resistance is governed by antioxidant Mn2+, gauged by paramagnetic resonance . Proc. Natl. Acad. Sci. U.S.A. 2017 ; 114 : E9253 – E9260 .

Zahradka K. , Slade D. , Bailone A. , Sommer S. , Averbeck D. , Petranovic M. , Lindner A.B. , Radman M. Reassembly of shattered chromosomes in Deinococcus radiodurans . Nature . 2006 ; 443 : 569 – 573 .

Slade D. , Lindner A.B. , Paul G. , Radman M. Recombination and replication in DNA repair of heavily irradiated Deinococcus radiodurans . Cell . 2009 ; 136 : 1044 – 1055 .

Magerand R. , Rey P. , Blanchard L. , de Groot A. Redox signaling through zinc activates the radiation response in Deinococcus bacteria . Sci. Rep. 2021 ; 11 : 4528 .

Narasimha A. , Basu B. New insights into the activation of radiation desiccation response regulon in Deinococcus radiodurans . J. Biosci. 2021 ; 46 : 10 .

Blanchard L. , Guérin P. , Roche D. , Cruveiller S. , Pignol D. , Vallenet D. , Armengaud J. , de Groot A. Conservation and diversity of the IrrE/DdrO-controlled radiation response in radiation-resistant Deinococcus bacteria . Microbiologyopen . 2017 ; 6 : e00477 .

Eugénie N. , Zivanovic Y. , Lelandais G. , Coste G. , Bouthier de la Tour C. , Bentchikou E. , Servant P. , Confalonieri F. Characterization of the radiation desiccation response regulon of the radioresistant bacterium Deinococcus radiodurans by Integrative Genomic analyses . Cells . 2021 ; 10 : 2536 .

Tanaka M. , Earl A.M. , Howell H.A. , Park M.-J. , Eisen J.A. , Peterson S.N. , Battista J.R. Analysis of Deinococcus radiodurans 's transcriptional response to ionizing radiation and desiccation reveals novel proteins that contribute to extreme radioresistance . Genetics . 2004 ; 168 : 21 – 33 .

Hua Y. , Narumi I. , Gao G. , Tian B. , Satoh K. , Kitayama S. , Shen B. PprI: a general switch responsible for extreme radioresistance of Deinococcus radiodurans . Biochem. Biophys. Res. Commun. 2003 ; 306 : 354 – 360 .

Narumi I. , Satoh K. , Cui S. , Funayama T. , Kitayama S. , Watanabe H. PprA: a novel protein from Deinococcus radiodurans that stimulates DNA ligation . Mol. Microbiol. 2004 ; 54 : 278 – 285 .

Devigne A. , Meyer L. , de la Tour C.B. , Eugénie N. , Sommer S. , Servant P. The absence of the RecN protein suppresses the cellular defects of Deinococcus radiodurans irradiated cells devoid of the PprA protein by limiting recombinational repair of DNA lesions . DNA Repair (Amst.) . 2019 ; 73 : 144 – 154 .

Devigne A. , Guérin P. , Lisboa J. , Quevillon-Cheruel S. , Armengaud J. , Sommer S. , Bouthier de la Tour C. , Servant P. PprA protein is involved in chromosome segregation via its physical and functional interaction with DNA gyrase in irradiated deinococcus radiodurans bacteria . mSphere . 2016 ; 1 : e00036-15 .

Kota S. , Charaka V.K. , Ringgaard S. , Waldor M.K. , Misra H.S. PprA contributes to deinococcus radiodurans resistance to nalidixic acid, genome maintenance after DNA damage and interacts with deinococcal topoisomerases . PLoS One . 2014 ; 9 : e85288 .

Iyer L.M. , Koonin E.V. , Aravind L Classification and evolutionary history of the single-strand annealing proteins, RecT, Redbeta, ERF and RAD52 . Bmc Genomics [Electronic Resource] . 2002 ; 3 : 8 .

Gutsche I. , Vujičić-Žagar A. , Siebert X. , Servant P. , Vannier F. , Castaing B. , Gallet B. , Heulin T. , de Groot A. , Sommer S. et al. . Complex oligomeric structure of a truncated form of DdrA: a protein required for the extreme radiotolerance of Deinococcus . Biochim. Biophys. Acta - Proteins Proteomics . 2008 ; 1784 : 1050 – 1058 .

Harris D.R. , Ngo K.V. , Cox M.M. The stable, functional core of DdrA from Deinococcus radiodurans R1 does not restore radioresistance in vivo . J. Bacteriol. 2008 ; 190 : 6475 – 6482 .

Sugiman-Marangos S.N. , Weiss Y.M. , Junop M.S. Mechanism for accurate, protein-assisted DNA annealing by Deinococcus radiodurans DdrB . Proc. Natl. Acad. Sci. U.S.A. 2016 ; 113 : 4308 – 4313 .

Bouthier de la Tour C. , Boisnard S. , Norais C. , Toueille M. , Bentchikou E. , Vannier F. , Cox M.M. , Sommer S. , Servant P. The deinococcal DdrB protein is involved in an early step of DNA double strand break repair and in plasmid transformation through its single-strand annealing activity . DNA Repair (Amst.) . 2011 ; 10 : 1223 – 1231 .

Xu G. , Lu H. , Wang L. , Chen H. , Xu Z. , Hu Y. , Tian B. , Hua Y. DdrB stimulates single-stranded DNA annealing and facilitates RecA-independent DNA repair in Deinococcus radiodurans . DNA Repair (Amst.) . 2010 ; 9 : 805 – 812 .

de la Tour C.B. , Mathieu M. , Servant P. , Coste G. , Norais C. , Confalonieri F. Characterization of the DdrD protein from the extremely radioresistant bacterium Deinococcus radiodurans . Extremophiles . 2021 ; 25 : 343 – 355 .

Bouthier de la Tour C. , Mathieu M. , Meyer L. , Dupaigne P. , Passot F. , Servant P. , Sommer S. , Le Cam E. , Confalonieri F. In vivo and in vitro characterization of DdrC, a DNA damage response protein in Deinococcus radiodurans bacterium . PLoS One . 2017 ; 12 : e0177751 .

Banneville A.-S. , Bouthier de la Tour C. , De Bonis S. , Hognon C. , Colletier J.-P. , Teulon J.-M. , Le Roy A. , Pellequer J.-L. , Monari A. , Dehez F. et al. . Structural and functional characterization of DdrC, a novel DNA damage-induced nucleoid associated protein involved in DNA compaction . Nucleic Acids Res. 2022 ; 50 : 7680 – 7696 .

Buzon B. , Grainger R. , Huang S. , Rzadki C. , Junop M.S. Structure-specific endonuclease activity of SNM1A enables processing of a DNA interstrand crosslink . Nucleic Acids Res. 2018 ; 46 : 9057 – 9066 .

Virtanen P. , Gommers R. , Oliphant T.E. , Haberland M. , Reddy T. , Cournapeau D. , Burovski E. , Peterson P. , Weckesser W. , Bright J. et al. . SciPy 1.0: fundamental algorithms for scientific computing in Python . Nat. Methods . 2020 ; 17 : 261 – 272 .

Vonrhein C. , Flensburg C. , Keller P. , Sharff A. , Smart O. , Paciorek W. , Womack T. , Bricogne G. Data processing and analysis with the autoPROC toolbox . Acta Crystallogr. Sect. D Biol. Crystallogr. 2011 ; 67 : 293 – 302 .

Liebschner D. , Afonine P.V. , Baker M.L. , Bunkóczi G. , Chen V.B. , Croll T.I. , Hintze B. , Hung L.-W. , Jain S. , McCoy A.J. et al. . Macromolecular structure determination using X-rays, neutrons and electrons: recent developments in Phenix . Acta Crystallogr. Sect. D Struct. Biol. 2019 ; 75 : 861 – 877 .

Cowtan K. Completion of autobuilt protein models using a database of protein fragments . Acta Crystallogr. Sect. D Biol. Crystallogr. 2012 ; 68 : 328 – 335 .

Emsley P. , Lohkamp B. , Scott W.G. , Cowtan K. Features and development of Coot . Acta Crystallogr. Sect. D Biol. Crystallogr. 2010 ; 66 : 486 – 501 .

Huang P.-S. , Ban Y.-E.A. , Richter F. , Andre I. , Vernon R. , Schief W.R. , Baker D. RosettaRemodel: a generalized framework for flexible backbone protein design . PLoS One . 2011 ; 6 : e24109 .

Alford R.F. , Leaver-Fay A. , Jeliazkov J.R. , O’Meara M.J. , DiMaio F.P. , Park H. , Shapovalov M.V. , Renfrew P.D. , Mulligan V.K. , Kappel K. et al. . The Rosetta all-atom energy function for macromolecular modeling and design . J. Chem. Theory Comput. 2017 ; 13 : 3031 – 3048 .

Holm L. Dali server: structural unification of protein families . Nucleic Acids Res. 2022 ; 50 : W210 – W215 .

Jurrus E. , Engel D. , Star K. , Monson K. , Brandi J. , Felberg L.E. , Brookes D.H. , Wilson L. , Chen J. , Liles K. et al. . Improvements to the APBS biomolecular solvation software suite . Protein Sci. 2018 ; 27 : 112 – 128 .

Banitt I. , Wolfson H.J. ParaDock: a flexible non-specific DNA–rigid protein docking algorithm . Nucleic Acids Res. 2011 ; 39 : e135 – e135 .

Conway P. , Tyka M.D. , DiMaio F. , Konerding D.E. , Baker D. Relaxation of backbone bond geometry improves protein energy landscape modeling . Protein Sci. 2014 ; 23 : 47 – 55 .

Baek M. , McHugh R. , Anishchenko I. , Baker D. , DiMaio F. Accurate prediction of nucleic acid and protein-nucleic acid complexes using RoseTTAFoldNA . Nat. Methods . 2024 ; 21 : 117 – 121 .

Chen A. , Sherman M.W. , Chu C. , Gonzalez N. , Patel T. , Contreras L.M. Discovery and characterization of native deinococcus radiodurans promoters for tunable gene expression . Appl. Environ. Microbiol. 2019 ; 85 : e01356-19 .

Meima R. , Lidstrom M.E. Characterization of the minimal replicon of a cryptic deinococcus radiodurans SARK plasmid and development of versatile Escherichia coli - D. radiodurans shuttle vectors . Appl. Environ. Microbiol. 2000 ; 66 : 3856 – 3867 .

Devigne A. , Mersaoui S. , Bouthier-de-la-Tour C. , Sommer S. , Servant P. The PprA protein is required for accurate cell division of gamma-irradiated Deinococcus radiodurans bacteria . DNA Repair (Amst.) . 2013 ; 12 : 265 – 272 .

Allerston C.K. , Lee S.Y. , Newman J.A. , Schofield C.J. , McHugh P.J. , Gileadi O. The structures of the SNM1A and SNM1B/apollo nuclease domains reveal a potential basis for their distinct DNA processing activities . Nucleic Acids Res. 2015 ; 43 : 11047 – 11060 .

Adachi M. , Hirayama H. , Shimizu R. , Satoh K. , Narumi I. , Kuroki R. Interaction of double-stranded DNA with polymerized PprA protein from Deinococcus radiodurans . Protein Sci. 2014 ; 23 : 1349 – 1358 .

Adachi M. , Shimizu R. , Shibazaki C. , Satoh K. , Fujiwara S. , Arai S. , Narumi I. , Kuroki R. Extended structure of pleiotropic DNA repair-promoting protein PprA from Deinococcus radiodurans . FASEB J. 2019 ; 33 : 3647 – 3658 .

Hirsch A.K.H. , Fischer F.R. , Diederich F. Phosphate recognition in structural biology . Angew. Chem. Int. Ed. Engl. 2007 ; 46 : 338 – 352 .

Yang W. Structure and mechanism for DNA lesion recognition . Cell Res. 2008 ; 18 : 184 – 197 .

Depew D.E. , Wang J.C. Conformational fluctuations of DNA helix . Proc. Natl. Acad. Sci. U.S.A. 1975 ; 72 : 4275 – 4279 .

Pulleyblank D.E. , Shure M. , Tang D. , Vinograd J. , Vosberg H.P. Action of nicking-closing enzyme on supercoiled and nonsupercoiled closed circular DNA: formation of a Boltzmann distribution of topological isomers . Proc. Natl. Acad. Sci. U.S.A. 1975 ; 72 : 4280 – 4284 .

Irobalieva R.N. , Fogg J.M. , Catanese D.J. , Sutthibutpong T. , Chen M. , Barker A.K. , Ludtke S.J. , Harris S.A. , Schmid M.F. , Chiu W. et al. . Structural diversity of supercoiled DNA . Nat. Commun. 2015 ; 6 : 8440 .

McCauley M.J. , Williams M.C. Mechanisms of DNA binding determined in optical tweezers experiments . Biopolymers . 2007 ; 85 : 154 – 168 .

Pyne A.L.B. , Noy A. , Main K.H.S. , Velasco-Berrelleza V. , Piperakis M.M. , Mitchenall L.A. , Cugliandolo F.M. , Beton J.G. , Stevenson C.E.M. , Hoogenboom B.W. et al. . Base-pair resolution analysis of the effect of supercoiling on DNA flexibility and major groove recognition by triplex-forming oligonucleotides . Nat. Commun. 2021 ; 12 : 1053 .

Sutthibutpong T. , Matek C. , Benham C. , Slade G.G. , Noy A. , Laughton C.K. , Doye J.P. , Louis A.A. , Harris S.A Long-range correlations in the mechanics of small DNA circles under topological stress revealed by multi-scale simulation . Nucleic Acids Res. 2016 ; 44 : 9121 – 9130 .

Fogg J.M. , Judge A.K. , Stricker E. , Chan H.L. , Zechiedrich L. Supercoiling and looping promote DNA base accessibility and coordination among distant sites . Nat. Commun. 2021 ; 12 : 5683 .

Matek C. , Ouldridge T.E. , Doyle J.P.K. , Louis A.A. Plectoneme tip bubbles: Coupled denaturation and writhing in supercoiled DNA . Sci. Rep. 2015 ; 5 : 7655 .

Pandey N. , Black B.E. Rapid detection and signaling of DNA damage by PARP-1 . Trends Biochem. Sci. 2021 ; 46 : 744 – 757 .

Eustermann S. , Wu W.-F. , Langelier M.-F. , Yang J.-C. , Easton L.E. , Riccio A.A. , Pascal J.M. , Neuhaus D. Structural basis of detection and signaling of DNA single-strand breaks by Human PARP-1 . Mol. Cell . 2015 ; 60 : 742 – 754 .

Chen X. , Velmurugu Y. , Zheng G. , Park B. , Shim Y. , Kim Y. , Liu L. , Van Houten B. , He C. , Ansari A. et al. . Kinetic gating mechanism of DNA damage recognition by Rad4/XPC . Nat. Commun. 2015 ; 6 : 5849 .

Velmurugu Y. , Chen X. , Slogoff Sevilla P. , Min J.-H. , Ansari A. Twist-open mechanism of DNA damage recognition by the Rad4/XPC nucleotide excision repair complex . Proc. Natl. Acad. Sci. U.S.A. 2016 ; 113 : E2296 – E305 .

Email alerts

Citing articles via.

• Editorial Board

Affiliations

• Online ISSN 1362-4962
• Print ISSN 0305-1048
• Copyright © 2024 Oxford University Press
• About Oxford Academic
• Publish journals with us
• University press partners
• What we publish
• New features  
• Open access
• Institutional account management
• Rights and permissions
• Get help with access
• Accessibility
• Advertising
• Media enquiries
• Oxford University Press
• Oxford Languages
• University of Oxford

Oxford University Press is a department of the University of Oxford. It furthers the University's objective of excellence in research, scholarship, and education by publishing worldwide

• Copyright © 2024 Oxford University Press
• Cookie settings
• Cookie policy
• Privacy policy
• Legal notice

This Feature Is Available To Subscribers Only

Sign In or Create an Account

This PDF is available to Subscribers Only

For full access to this pdf, sign in to an existing account, or purchase an annual subscription.

Chemical Society Reviews

Heavier group 14-transition metal π-complex congeners †.

a Fakultät für Chemie, Technische Universität München, Lichtenbergstraße 4, 85748 Garching bei München, Germany E-mail: [email protected]

Since the dawn of organometallic chemistry, transition metal complexes of unsaturated organic molecules, namely π-complexes, have remained a central focus: our thorough understanding of the electronic nature of such species, and their importance in countless reactive processes continues to drive research in their synthesis and utilisation. Since the late 1900s, research regarding the related chemistry for the heavier group 14 elements has become increasingly more fervent. Today, heavier congeners of a vast array of classical π-complexes have been realised, from alkene to arene systems, involving Si, Ge, Sn, and Pb. This has given deeper insights into the bonding observed for these heavier elements, which typically involves a lessened degree of π-bonding and an increased polarisation. This review aims to summarise this field, identifying these disparities, and highlighting areas which we believe may be exciting for future exploration.

Article information

Download Citation

Permissions.

Heavier group 14-transition metal π-complex congeners

T. J. Hadlington, Chem. Soc. Rev. , 2024, Advance Article , DOI: 10.1039/D4CS00497C

This article is licensed under a Creative Commons Attribution 3.0 Unported Licence . You can use material from this article in other publications without requesting further permissions from the RSC, provided that the correct acknowledgement is given.

Read more about how to correctly acknowledge RSC content .

Social activity

Search articles by author.

This article has not yet been cited.

Advertisements

Information

• Author Services

Initiatives

You are accessing a machine-readable page. In order to be human-readable, please install an RSS reader.

All articles published by MDPI are made immediately available worldwide under an open access license. No special permission is required to reuse all or part of the article published by MDPI, including figures and tables. For articles published under an open access Creative Common CC BY license, any part of the article may be reused without permission provided that the original article is clearly cited. For more information, please refer to https://www.mdpi.com/openaccess .

Feature papers represent the most advanced research with significant potential for high impact in the field. A Feature Paper should be a substantial original Article that involves several techniques or approaches, provides an outlook for future research directions and describes possible research applications.

Feature papers are submitted upon individual invitation or recommendation by the scientific editors and must receive positive feedback from the reviewers.

Editor’s Choice articles are based on recommendations by the scientific editors of MDPI journals from around the world. Editors select a small number of articles recently published in the journal that they believe will be particularly interesting to readers, or important in the respective research area. The aim is to provide a snapshot of some of the most exciting work published in the various research areas of the journal.

Original Submission Date Received: .

• Active Journals
• Find a Journal
• Proceedings Series
• For Authors
• For Reviewers
• For Editors
• For Librarians
• For Publishers
• For Societies
• For Conference Organizers
• Open Access Policy
• Institutional Open Access Program
• Special Issues Guidelines
• Editorial Process
• Research and Publication Ethics
• Article Processing Charges
• Testimonials
• Preprints.org
• SciProfiles
• Encyclopedia

Article Menu

• Subscribe SciFeed
• Recommended Articles
• Author Biographies
• Google Scholar
• on Google Scholar
• Table of Contents

Find support for a specific problem in the support section of our website.

Please let us know what you think of our products and services.

Visit our dedicated information section to learn more about MDPI.

JSmol Viewer

Anomaly detection for charging voltage profiles in battery cells in an energy storage station based on robust principal component analysis, 1. introduction, 2. source and preprocessing of data, 3. anomaly detection process for battery cells, 3.1. the principle of rpca, 3.2. consistency assessment for battery cells, 3.3. sceening and identification, 4. experimental analysis and verification, 4.1. experimental analysis, 4.2. comparison and verification, 4.3. anomaly reasons and analysis, 5. conclusions, author contributions, institutional review board statement, informed consent statement, data availability statement, conflicts of interest.

• Zubi, G.; Dufo-López, R.; Carvalho, M.; Pasaoglu, G. The lithium-ion battery: State of the art and future perspectives. Renew. Sustain. Energy Rev. 2018 , 89 , 292–308. [ Google Scholar ] [ CrossRef ]
• Tarascon, J.M.; Armand, M. Issues and challenges facing rechargeable lithium batteries. Nature 2001 , 414 , 359–367. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Xiong, R.; Sun, W.; Yu, Q.; Sun, F. Research progress, challenges and prospects of fault diagnosis on battery system of electric vehicles. Appl. Energy 2020 , 279 , 115855. [ Google Scholar ] [ CrossRef ]
• Ghaeminezhad, N.; Ouyang, Q.; Hu, X.; Xu, G.; Wang, Z. Active Cell Equalization Topologies Analysis for Battery Packs: A Systematic Review. IEEE Trans. Power Electron. 2021 , 36 , 9119–9135. [ Google Scholar ] [ CrossRef ]
• Hong, J.; Wang, Z.; Qu, C.; Zhou, Y.; Shan, T.; Zhang, J.; Hou, Y. Investigation on overcharge-caused thermal runaway of lithium-ion batteries in real-world electric vehicles. Appl. Energy 2022 , 321 , 119229. [ Google Scholar ] [ CrossRef ]
• Sun, Z.; Wang, Z.; Liu, P.; Zhang, Z.; Wang, S.; Dorrell, D.G. Relative Entropy based Lithium-ion Battery Pack Short Circuit Detection for Electric Vehicle. In Proceedings of the 2020 IEEE Energy Conversion Congress and Exposition (ECCE), Detroit, MI, USA, 11–15 October 2020; pp. 5061–5067. [ Google Scholar ]
• Jiang, J.; Cong, X.; Li, S.; Zhang, C.; Zhang, W.; Jiang, Y. A Hybrid Signal-Based Fault Diagnosis Method for Lithium-Ion Batteries in Electric Vehicles. IEEE Access 2021 , 9 , 19175–19186. [ Google Scholar ] [ CrossRef ]
• Yang, B.; Chen, Y.; Guo, Z.; Wang, J.; Zeng, C.; Li, D.; Shu, H.; Shan, J.; Fu, T.; Zhang, X. Levenberg-Marquardt backpropagation algorithm for parameter identification of solid oxide fuel cells. Int. J. Energy Res. 2021 , 45 , 17903–17923. [ Google Scholar ] [ CrossRef ]
• Li, Z.; Zeng, L. A Hybrid Vertex Outlier Detection Method Based on Distributed Representation and Local Outlier Factor. In Proceedings of the 2015 IEEE 12th Intl Conf on Ubiquitous Intelligence and Computing and 2015 IEEE 12th Intl Conf on Autonomic and Trusted Computing and 2015 IEEE 15th Intl Conf on Scalable Computing and Communications and Its Associated Workshops (UIC-ATC-ScalCom), Beijing, China, 10–14 August 2015; pp. 512–516. [ Google Scholar ]
• Hu, C.; Jain, G.; Zhang, P.; Schmidt, C.; Gomadam, P.; Gorka, T. Data-driven method based on particle swarm optimization and k-nearest neighbor regression for estimating capacity of lithium-ion battery. Appl. Energy 2014 , 129 , 49–55. [ Google Scholar ] [ CrossRef ]
• Song, L.; Zhang, K.; Liang, T.; Han, X.; Zhang, Y. Intelligent state of health estimation for lithium-ion battery pack based on big data analysis. J. Energy Storage 2020 , 32 , 101836. [ Google Scholar ] [ CrossRef ]
• Khaleghi, S.; Firouz, Y.; Van Mierlo, J.; Van den Bossche, P. Developing a real-time data-driven battery health diagnosis method, using time and frequency domain condition indicators. Appl. Energy 2019 , 255 , 113813. [ Google Scholar ] [ CrossRef ]
• Zeng, J.; Zhang, Y.; Zhang, Z.; Shan, F.; Shen, Z.; Liu, X. Identification of power battery voltage inconsistency faults in electric vehicles based on K-means++ clustering with dynamic k-values. Sci. Sin. Technol. 2023 , 53 , 28–40. [ Google Scholar ]
• Zhao, Y.; Liu, P.; Wang, Z.; Zhang, L.; Hong, J. Fault and defect diagnosis of battery for electric vehicles based on big data analysis methods. Appl. Energy 2017 , 207 , 354–362. [ Google Scholar ] [ CrossRef ]
• Li, F.; Min, Y.; Zhang, Y.; Wang, C. A Method for Abnormal Battery Charging Capacity Diagnosis Based on Electric Vehicles Operation Data. Batteries 2023 , 9 , 103. [ Google Scholar ] [ CrossRef ]
• Piao, C.; Huang, Z.; Su, L.; Lu, S. Research on Outlier Detection Algorithm for Evaluation of Battery System Safety. Adv. Mech. Eng. 2014 , 6 , 830402. [ Google Scholar ] [ CrossRef ]
• Li, X.; Wang, Z. A novel fault diagnosis method for lithium-Ion battery packs of electric vehicles. Measurement 2018 , 116 , 402–411. [ Google Scholar ] [ CrossRef ]
• Ma, M.; Wang, Y.; Duan, Q.; Wu, T.; Sun, J.; Wang, Q. Fault detection of the connection of lithium-ion power batteries in series for electric vehicles based on statistical analysis. Energy 2018 , 164 , 745–756. [ Google Scholar ] [ CrossRef ]
• Wang, Z.; Hong, J.; Zhang, L.; Liu, P. Voltage Fault Detection and Precaution of Batteries Based on Entropy and Standard Deviation for Electric Vehicles. Energy Procedia 2017 , 105 , 2163–2168. [ Google Scholar ] [ CrossRef ]
• Wang, Z.; Hong, J.; Liu, P.; Zhang, L. Voltage fault diagnosis and prognosis of battery systems based on entropy and Z-score for electric vehicles. Appl. Energy 2017 , 196 , 289–302. [ Google Scholar ] [ CrossRef ]
• Lin, M.; Xie, H.; Shan, M. A Hybrid Multiscale Permutation Entropy-Based Fault Diagnosis and Inconsistency Evaluation Approach for Lithium Battery of E-Vehicles. IEEE Access 2022 , 10 , 104757–104768. [ Google Scholar ] [ CrossRef ]
• Yang, D.; Yang, X.; Liao, G.; Zhu, S. Strong Clutter Suppression via RPCA in Multichannel SAR/GMTI System. IEEE Geosci. Remote Sens. Lett. 2015 , 12 , 2237–2241. [ Google Scholar ] [ CrossRef ]
• Lin, Z.; Chen, M.; Ma, Y. The Augmented Lagrange Multiplier Method for Exact Recovery of Corrupted Low-Rank Matrices. J. Struct. Biol. 2010 , 181 , 116–127. [ Google Scholar ]

Click here to enlarge figure

Share and Cite

Yu, J.; Guo, Y.; Zhang, W. Anomaly Detection for Charging Voltage Profiles in Battery Cells in an Energy Storage Station Based on Robust Principal Component Analysis. Appl. Sci. 2024 , 14 , 7552. https://doi.org/10.3390/app14177552

Yu J, Guo Y, Zhang W. Anomaly Detection for Charging Voltage Profiles in Battery Cells in an Energy Storage Station Based on Robust Principal Component Analysis. Applied Sciences . 2024; 14(17):7552. https://doi.org/10.3390/app14177552

Yu, Jiaqi, Yanjie Guo, and Wenjie Zhang. 2024. "Anomaly Detection for Charging Voltage Profiles in Battery Cells in an Energy Storage Station Based on Robust Principal Component Analysis" Applied Sciences 14, no. 17: 7552. https://doi.org/10.3390/app14177552

Article Metrics

Article access statistics, further information, mdpi initiatives, follow mdpi.

Subscribe to receive issue release notifications and newsletters from MDPI journals